Incidental Mutation 'R4196:Mrps9'
ID 318547
Institutional Source Beutler Lab
Gene Symbol Mrps9
Ensembl Gene ENSMUSG00000060679
Gene Name mitochondrial ribosomal protein S9
Synonyms
MMRRC Submission 041027-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock # R4196 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 42851233-42905683 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to G at 42901094 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000057208]
AlphaFold Q9D7N3
Predicted Effect probably benign
Transcript: ENSMUST00000057208
SMART Domains Protein: ENSMUSP00000056855
Gene: ENSMUSG00000060679

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
Pfam:Ribosomal_S9 268 390 7.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187414
Predicted Effect probably benign
Transcript: ENSMUST00000201108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202358
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,263,556 probably benign Het
Acmsd T G 1: 127,749,194 L152R probably damaging Het
Ankle2 A G 5: 110,244,543 K472E possibly damaging Het
Aup1 T C 6: 83,055,230 V126A probably damaging Het
Baz1a T C 12: 54,911,415 Y1014C probably damaging Het
Bcl9 A T 3: 97,216,368 probably benign Het
Cnot2 A T 10: 116,501,304 N221K possibly damaging Het
Col19a1 G A 1: 24,534,052 S213L unknown Het
Eif4enif1 T C 11: 3,243,186 V675A possibly damaging Het
Elp3 A G 14: 65,548,002 L450P probably damaging Het
Erbb4 C T 1: 68,343,855 D328N possibly damaging Het
Fbll1 T A 11: 35,797,872 H188L possibly damaging Het
Frem2 A G 3: 53,539,268 F2360L possibly damaging Het
Gm2396 A G 9: 88,917,662 noncoding transcript Het
Gulo G T 14: 65,988,253 P375T possibly damaging Het
Hspd1 T C 1: 55,086,909 M11V probably benign Het
Ikbkap A T 4: 56,755,353 N1295K probably damaging Het
Itgav A G 2: 83,768,327 T243A probably benign Het
Lipg C T 18: 74,945,831 R450H probably damaging Het
Lrp3 T A 7: 35,203,410 S504C probably damaging Het
Nlgn1 A G 3: 25,434,392 V564A probably damaging Het
Ntf3 T C 6: 126,102,175 T110A probably benign Het
Pkd1l1 T A 11: 8,909,929 I560F probably damaging Het
Prepl T C 17: 85,081,154 T174A probably benign Het
Ptprg A T 14: 12,122,002 T289S possibly damaging Het
Rab11fip2 T C 19: 59,935,781 T222A probably damaging Het
Rhbdd3 G T 11: 5,099,460 probably benign Het
Sept4 C A 11: 87,588,772 D239E probably damaging Het
Shprh A G 10: 11,207,860 probably benign Het
Slc3a1 T A 17: 85,060,878 W525R probably damaging Het
Trim75 A G 8: 64,982,764 S345P probably damaging Het
Usp5 C T 6: 124,824,938 E72K possibly damaging Het
Vmn1r225 T A 17: 20,502,975 M226K probably benign Het
Wnk4 T A 11: 101,269,631 V697E probably damaging Het
Zbtb9 C T 17: 26,973,879 T86I probably benign Het
Other mutations in Mrps9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mrps9 APN 1 42905459 missense probably damaging 1.00
IGL01134:Mrps9 APN 1 42903397 missense probably damaging 0.97
IGL01557:Mrps9 APN 1 42851350 missense probably benign
IGL02541:Mrps9 APN 1 42862654 splice site probably null
PIT4402001:Mrps9 UTSW 1 42896098 missense probably benign 0.10
R0598:Mrps9 UTSW 1 42905417 missense probably damaging 1.00
R1718:Mrps9 UTSW 1 42903399 missense probably damaging 1.00
R4195:Mrps9 UTSW 1 42901094 intron probably benign
R4695:Mrps9 UTSW 1 42862515 missense possibly damaging 0.59
R4840:Mrps9 UTSW 1 42898415 intron probably benign
R5033:Mrps9 UTSW 1 42895331 splice site probably null
R5489:Mrps9 UTSW 1 42898433 splice site probably benign
R5876:Mrps9 UTSW 1 42895378 missense probably damaging 0.99
R6891:Mrps9 UTSW 1 42905413 missense probably damaging 1.00
R7015:Mrps9 UTSW 1 42898546 missense probably benign 0.04
R7940:Mrps9 UTSW 1 42862648 missense probably damaging 0.98
R8679:Mrps9 UTSW 1 42879755 missense probably damaging 0.99
R9117:Mrps9 UTSW 1 42903377 missense probably benign 0.22
Z1177:Mrps9 UTSW 1 42899458 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCGAAAGATGTCAGTGCCTAC -3'
(R):5'- TCACAGAAATAACCCTGGGAGG -3'

Sequencing Primer
(F):5'- AGATGTCAGTGCCTACTATTAGATGG -3'
(R):5'- CCTGGGAGGATGAACAGGTCC -3'
Posted On 2015-06-10