Incidental Mutation 'R4196:Itgav'
ID 318551
Institutional Source Beutler Lab
Gene Symbol Itgav
Ensembl Gene ENSMUSG00000027087
Gene Name integrin alpha V
Synonyms 1110004F14Rik, D430040G12Rik, CD51, vitronectin receptor alpha polypeptide (VNRA), 2610028E01Rik, alphav-integrin
MMRRC Submission 041027-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4196 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 83554796-83637261 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83598671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 243 (T243A)
Ref Sequence ENSEMBL: ENSMUSP00000107369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028499] [ENSMUST00000111740]
AlphaFold P43406
Predicted Effect probably benign
Transcript: ENSMUST00000028499
AA Change: T279A

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028499
Gene: ENSMUSG00000027087
AA Change: T279A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 248 298 4.9e-13 SMART
Int_alpha 302 363 4.55e-8 SMART
Int_alpha 366 422 2.2e-15 SMART
Int_alpha 430 484 1.62e-4 SMART
SCOP:d1m1xa2 629 767 3e-49 SMART
SCOP:d1m1xa3 768 982 1e-89 SMART
low complexity region 995 1008 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111740
AA Change: T243A

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107369
Gene: ENSMUSG00000027087
AA Change: T243A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Int_alpha 45 104 1.05e-3 SMART
Int_alpha 212 262 4.9e-13 SMART
Int_alpha 266 327 4.55e-8 SMART
Int_alpha 330 386 2.2e-15 SMART
Int_alpha 394 448 1.62e-4 SMART
SCOP:d1m1xa2 593 731 5e-49 SMART
SCOP:d1m1xa3 732 946 2e-89 SMART
low complexity region 959 972 N/A INTRINSIC
Pfam:Integrin_alpha 977 991 1.3e-7 PFAM
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 1, beta 3, beta 6 and beta 8. The heterodimer of alpha v and beta 3 forms the Vitronectin receptor. This protein interacts with several extracellular matrix proteins to mediate cell adhesion and may play a role in cell migration. In mouse, deficiency of this gene is associated with defects in vascular morphogenesis in the brain and early post-natal death. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit placental defects, intracerebral and intestinal hemorrhages, and cleft palate, resulting in death occurring as early as midgestation and as late as shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,676,931 (GRCm39) L152R probably damaging Het
Ankle2 A G 5: 110,392,409 (GRCm39) K472E possibly damaging Het
Aup1 T C 6: 83,032,211 (GRCm39) V126A probably damaging Het
Baz1a T C 12: 54,958,200 (GRCm39) Y1014C probably damaging Het
Bcl9 A T 3: 97,123,684 (GRCm39) probably benign Het
Bltp2 A G 11: 78,154,382 (GRCm39) probably benign Het
Cnot2 A T 10: 116,337,209 (GRCm39) N221K possibly damaging Het
Col19a1 G A 1: 24,573,133 (GRCm39) S213L unknown Het
Eif4enif1 T C 11: 3,193,186 (GRCm39) V675A possibly damaging Het
Elp1 A T 4: 56,755,353 (GRCm39) N1295K probably damaging Het
Elp3 A G 14: 65,785,451 (GRCm39) L450P probably damaging Het
Erbb4 C T 1: 68,383,014 (GRCm39) D328N possibly damaging Het
Fbll1 T A 11: 35,688,699 (GRCm39) H188L possibly damaging Het
Frem2 A G 3: 53,446,689 (GRCm39) F2360L possibly damaging Het
Gm2396 A G 9: 88,799,715 (GRCm39) noncoding transcript Het
Gulo G T 14: 66,225,702 (GRCm39) P375T possibly damaging Het
Hspd1 T C 1: 55,126,068 (GRCm39) M11V probably benign Het
Lipg C T 18: 75,078,902 (GRCm39) R450H probably damaging Het
Lrp3 T A 7: 34,902,835 (GRCm39) S504C probably damaging Het
Mrps9 T G 1: 42,940,254 (GRCm39) probably benign Het
Nlgn1 A G 3: 25,488,556 (GRCm39) V564A probably damaging Het
Ntf3 T C 6: 126,079,138 (GRCm39) T110A probably benign Het
Pkd1l1 T A 11: 8,859,929 (GRCm39) I560F probably damaging Het
Prepl T C 17: 85,388,582 (GRCm39) T174A probably benign Het
Ptprg A T 14: 12,122,002 (GRCm38) T289S possibly damaging Het
Rab11fip2 T C 19: 59,924,213 (GRCm39) T222A probably damaging Het
Rhbdd3 G T 11: 5,049,460 (GRCm39) probably benign Het
Septin4 C A 11: 87,479,598 (GRCm39) D239E probably damaging Het
Shprh A G 10: 11,083,604 (GRCm39) probably benign Het
Slc3a1 T A 17: 85,368,306 (GRCm39) W525R probably damaging Het
Trim75 A G 8: 65,435,416 (GRCm39) S345P probably damaging Het
Usp5 C T 6: 124,801,901 (GRCm39) E72K possibly damaging Het
Vmn1r225 T A 17: 20,723,237 (GRCm39) M226K probably benign Het
Wnk4 T A 11: 101,160,457 (GRCm39) V697E probably damaging Het
Zbtb9 C T 17: 27,192,853 (GRCm39) T86I probably benign Het
Other mutations in Itgav
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Itgav APN 2 83,633,339 (GRCm39) missense probably damaging 1.00
IGL01969:Itgav APN 2 83,633,627 (GRCm39) missense probably damaging 1.00
IGL02371:Itgav APN 2 83,600,397 (GRCm39) missense probably damaging 1.00
IGL02563:Itgav APN 2 83,601,580 (GRCm39) missense probably benign
IGL02640:Itgav APN 2 83,622,283 (GRCm39) missense probably benign 0.33
IGL02641:Itgav APN 2 83,598,689 (GRCm39) splice site probably benign
IGL02927:Itgav APN 2 83,625,884 (GRCm39) missense probably damaging 1.00
IGL03172:Itgav APN 2 83,596,190 (GRCm39) missense possibly damaging 0.51
R0158:Itgav UTSW 2 83,622,381 (GRCm39) missense probably benign 0.33
R0346:Itgav UTSW 2 83,622,953 (GRCm39) missense probably damaging 1.00
R0508:Itgav UTSW 2 83,623,002 (GRCm39) splice site probably benign
R0546:Itgav UTSW 2 83,633,586 (GRCm39) missense probably benign 0.04
R0554:Itgav UTSW 2 83,624,614 (GRCm39) missense possibly damaging 0.95
R1122:Itgav UTSW 2 83,622,283 (GRCm39) missense probably benign 0.33
R1468:Itgav UTSW 2 83,596,245 (GRCm39) splice site probably benign
R1566:Itgav UTSW 2 83,566,974 (GRCm39) missense probably damaging 1.00
R1657:Itgav UTSW 2 83,632,123 (GRCm39) missense probably benign 0.21
R1892:Itgav UTSW 2 83,601,680 (GRCm39) missense probably damaging 1.00
R1912:Itgav UTSW 2 83,625,830 (GRCm39) missense possibly damaging 0.85
R2176:Itgav UTSW 2 83,633,599 (GRCm39) missense probably damaging 1.00
R2438:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R2449:Itgav UTSW 2 83,599,094 (GRCm39) critical splice donor site probably null
R3110:Itgav UTSW 2 83,622,915 (GRCm39) nonsense probably null
R3112:Itgav UTSW 2 83,622,915 (GRCm39) nonsense probably null
R3176:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R3177:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R3276:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R3277:Itgav UTSW 2 83,606,886 (GRCm39) missense probably damaging 1.00
R3766:Itgav UTSW 2 83,632,229 (GRCm39) critical splice donor site probably null
R3774:Itgav UTSW 2 83,622,308 (GRCm39) missense probably damaging 1.00
R3880:Itgav UTSW 2 83,598,645 (GRCm39) missense probably damaging 1.00
R4287:Itgav UTSW 2 83,555,184 (GRCm39) nonsense probably null
R4620:Itgav UTSW 2 83,586,246 (GRCm39) missense probably benign 0.07
R4790:Itgav UTSW 2 83,586,154 (GRCm39) missense probably damaging 1.00
R4946:Itgav UTSW 2 83,619,327 (GRCm39) missense probably benign 0.16
R6150:Itgav UTSW 2 83,606,780 (GRCm39) missense probably benign
R6345:Itgav UTSW 2 83,632,380 (GRCm39) missense probably damaging 1.00
R6482:Itgav UTSW 2 83,624,614 (GRCm39) missense probably damaging 1.00
R6900:Itgav UTSW 2 83,633,591 (GRCm39) missense probably damaging 1.00
R7247:Itgav UTSW 2 83,555,179 (GRCm39) missense probably damaging 0.98
R7317:Itgav UTSW 2 83,625,327 (GRCm39) missense probably benign 0.12
R7429:Itgav UTSW 2 83,624,602 (GRCm39) missense probably damaging 1.00
R7430:Itgav UTSW 2 83,624,602 (GRCm39) missense probably damaging 1.00
R7522:Itgav UTSW 2 83,632,373 (GRCm39) missense probably benign 0.10
R7546:Itgav UTSW 2 83,606,894 (GRCm39) nonsense probably null
R7578:Itgav UTSW 2 83,578,219 (GRCm39) missense probably benign 0.16
R8311:Itgav UTSW 2 83,596,121 (GRCm39) missense probably damaging 1.00
R8497:Itgav UTSW 2 83,615,805 (GRCm39) missense probably damaging 1.00
R8744:Itgav UTSW 2 83,600,427 (GRCm39) missense probably benign 0.25
R9752:Itgav UTSW 2 83,600,451 (GRCm39) critical splice donor site probably null
V1662:Itgav UTSW 2 83,614,198 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATTTGTAAGGCTCTGGCAGG -3'
(R):5'- ACATGTGTCAAAGTTGAGTGTCTTC -3'

Sequencing Primer
(F):5'- AGGGCCTCTCAGGAGATAGC -3'
(R):5'- GTGTCAAAGTTGAGTGTCTTCATCCC -3'
Posted On 2015-06-10