Incidental Mutation 'R4196:Cnot2'
ID 318565
Institutional Source Beutler Lab
Gene Symbol Cnot2
Ensembl Gene ENSMUSG00000020166
Gene Name CCR4-NOT transcription complex, subunit 2
Synonyms 2600016M12Rik, 2810470K03Rik
MMRRC Submission 041027-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.894) question?
Stock # R4196 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 116321066-116417416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 116337209 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 221 (N221K)
Ref Sequence ENSEMBL: ENSMUSP00000132152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105265] [ENSMUST00000105267] [ENSMUST00000164088] [ENSMUST00000167706] [ENSMUST00000168036] [ENSMUST00000169921] [ENSMUST00000169507] [ENSMUST00000169576] [ENSMUST00000218490]
AlphaFold Q8C5L3
Predicted Effect possibly damaging
Transcript: ENSMUST00000105265
AA Change: N136K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100900
Gene: ENSMUSG00000020166
AA Change: N136K

DomainStartEndE-ValueType
low complexity region 68 87 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
Pfam:NOT2_3_5 310 437 1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105267
AA Change: N221K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100902
Gene: ENSMUSG00000020166
AA Change: N221K

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 396 521 8.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164088
AA Change: N180K

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127830
Gene: ENSMUSG00000020166
AA Change: N180K

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166166
Predicted Effect probably benign
Transcript: ENSMUST00000167706
AA Change: N221K

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128837
Gene: ENSMUSG00000020166
AA Change: N221K

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:NOT2_3_5 345 472 2.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171214
Predicted Effect probably benign
Transcript: ENSMUST00000168036
AA Change: N180K

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132315
Gene: ENSMUSG00000020166
AA Change: N180K

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169937
Predicted Effect possibly damaging
Transcript: ENSMUST00000169921
AA Change: N221K

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132152
Gene: ENSMUSG00000020166
AA Change: N221K

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 395 522 1.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219544
Predicted Effect probably benign
Transcript: ENSMUST00000169507
Predicted Effect probably benign
Transcript: ENSMUST00000169576
Predicted Effect probably benign
Transcript: ENSMUST00000218490
Meta Mutation Damage Score 0.2168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the multi-component CCR4-NOT complex. The CCR4-NOT complex regulates mRNA synthesis and degradation and is also thought to be involved in mRNA splicing, transport and localization. The encoded protein interacts with histone deacetylases and functions as a repressor of polymerase II transcription. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,676,931 (GRCm39) L152R probably damaging Het
Ankle2 A G 5: 110,392,409 (GRCm39) K472E possibly damaging Het
Aup1 T C 6: 83,032,211 (GRCm39) V126A probably damaging Het
Baz1a T C 12: 54,958,200 (GRCm39) Y1014C probably damaging Het
Bcl9 A T 3: 97,123,684 (GRCm39) probably benign Het
Bltp2 A G 11: 78,154,382 (GRCm39) probably benign Het
Col19a1 G A 1: 24,573,133 (GRCm39) S213L unknown Het
Eif4enif1 T C 11: 3,193,186 (GRCm39) V675A possibly damaging Het
Elp1 A T 4: 56,755,353 (GRCm39) N1295K probably damaging Het
Elp3 A G 14: 65,785,451 (GRCm39) L450P probably damaging Het
Erbb4 C T 1: 68,383,014 (GRCm39) D328N possibly damaging Het
Fbll1 T A 11: 35,688,699 (GRCm39) H188L possibly damaging Het
Frem2 A G 3: 53,446,689 (GRCm39) F2360L possibly damaging Het
Gm2396 A G 9: 88,799,715 (GRCm39) noncoding transcript Het
Gulo G T 14: 66,225,702 (GRCm39) P375T possibly damaging Het
Hspd1 T C 1: 55,126,068 (GRCm39) M11V probably benign Het
Itgav A G 2: 83,598,671 (GRCm39) T243A probably benign Het
Lipg C T 18: 75,078,902 (GRCm39) R450H probably damaging Het
Lrp3 T A 7: 34,902,835 (GRCm39) S504C probably damaging Het
Mrps9 T G 1: 42,940,254 (GRCm39) probably benign Het
Nlgn1 A G 3: 25,488,556 (GRCm39) V564A probably damaging Het
Ntf3 T C 6: 126,079,138 (GRCm39) T110A probably benign Het
Pkd1l1 T A 11: 8,859,929 (GRCm39) I560F probably damaging Het
Prepl T C 17: 85,388,582 (GRCm39) T174A probably benign Het
Ptprg A T 14: 12,122,002 (GRCm38) T289S possibly damaging Het
Rab11fip2 T C 19: 59,924,213 (GRCm39) T222A probably damaging Het
Rhbdd3 G T 11: 5,049,460 (GRCm39) probably benign Het
Septin4 C A 11: 87,479,598 (GRCm39) D239E probably damaging Het
Shprh A G 10: 11,083,604 (GRCm39) probably benign Het
Slc3a1 T A 17: 85,368,306 (GRCm39) W525R probably damaging Het
Trim75 A G 8: 65,435,416 (GRCm39) S345P probably damaging Het
Usp5 C T 6: 124,801,901 (GRCm39) E72K possibly damaging Het
Vmn1r225 T A 17: 20,723,237 (GRCm39) M226K probably benign Het
Wnk4 T A 11: 101,160,457 (GRCm39) V697E probably damaging Het
Zbtb9 C T 17: 27,192,853 (GRCm39) T86I probably benign Het
Other mutations in Cnot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cnot2 APN 10 116,342,976 (GRCm39) missense probably benign 0.02
IGL02433:Cnot2 APN 10 116,328,241 (GRCm39) missense possibly damaging 0.82
IGL03066:Cnot2 APN 10 116,335,262 (GRCm39) missense probably benign 0.15
IGL03383:Cnot2 APN 10 116,330,722 (GRCm39) splice site probably benign
R0145:Cnot2 UTSW 10 116,353,273 (GRCm39) missense possibly damaging 0.90
R0497:Cnot2 UTSW 10 116,334,260 (GRCm39) missense probably damaging 1.00
R0615:Cnot2 UTSW 10 116,334,141 (GRCm39) missense possibly damaging 0.89
R1935:Cnot2 UTSW 10 116,334,320 (GRCm39) missense possibly damaging 0.62
R1985:Cnot2 UTSW 10 116,363,781 (GRCm39) missense probably damaging 0.99
R2148:Cnot2 UTSW 10 116,342,185 (GRCm39) missense probably benign 0.01
R4063:Cnot2 UTSW 10 116,373,301 (GRCm39) missense possibly damaging 0.46
R4179:Cnot2 UTSW 10 116,334,048 (GRCm39) missense possibly damaging 0.81
R4523:Cnot2 UTSW 10 116,417,379 (GRCm39) unclassified probably benign
R4572:Cnot2 UTSW 10 116,330,751 (GRCm39) missense probably benign 0.37
R4610:Cnot2 UTSW 10 116,335,323 (GRCm39) missense probably damaging 1.00
R5219:Cnot2 UTSW 10 116,342,215 (GRCm39) splice site probably null
R5847:Cnot2 UTSW 10 116,363,851 (GRCm39) missense probably damaging 0.98
R6444:Cnot2 UTSW 10 116,335,260 (GRCm39) missense probably benign 0.02
R6733:Cnot2 UTSW 10 116,334,058 (GRCm39) missense possibly damaging 0.81
R6734:Cnot2 UTSW 10 116,334,058 (GRCm39) missense possibly damaging 0.81
R6735:Cnot2 UTSW 10 116,334,058 (GRCm39) missense possibly damaging 0.81
R6944:Cnot2 UTSW 10 116,373,128 (GRCm39) intron probably benign
R7139:Cnot2 UTSW 10 116,330,924 (GRCm39) missense probably benign 0.00
R7248:Cnot2 UTSW 10 116,334,278 (GRCm39) missense probably benign 0.05
R7423:Cnot2 UTSW 10 116,328,303 (GRCm39) missense probably damaging 1.00
R7526:Cnot2 UTSW 10 116,342,985 (GRCm39) missense probably benign 0.12
R7851:Cnot2 UTSW 10 116,373,337 (GRCm39) missense possibly damaging 0.66
R8245:Cnot2 UTSW 10 116,346,294 (GRCm39) missense probably benign 0.07
R8350:Cnot2 UTSW 10 116,322,181 (GRCm39) missense probably damaging 1.00
R8463:Cnot2 UTSW 10 116,353,236 (GRCm39) missense probably benign 0.11
R9045:Cnot2 UTSW 10 116,322,160 (GRCm39) missense probably benign 0.05
R9175:Cnot2 UTSW 10 116,334,051 (GRCm39) missense possibly damaging 0.94
R9229:Cnot2 UTSW 10 116,384,960 (GRCm39) nonsense probably null
R9343:Cnot2 UTSW 10 116,346,326 (GRCm39) missense
R9508:Cnot2 UTSW 10 116,329,616 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTACACATGACTGTAGCC -3'
(R):5'- GCCCACTGTCATGTACCTAC -3'

Sequencing Primer
(F):5'- CACATGACTGTAGCCTTTATTTGG -3'
(R):5'- ACGCCCACTGTCGTGTAC -3'
Posted On 2015-06-10