Mutagenetix > Incidental Mutations

Incidental Mutation 'R4196:Eif4enif1'

318566

Institutional Source

Beutler Lab

Gene Symbol

Eif4enif1

Ensembl Gene

ENSMUSG00000020454

Gene Name

eukaryotic translation initiation factor 4E nuclear import factor 1

Synonyms

D11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik

MMRRC Submission

041027-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.554) question?

Stock #

R4196 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3202392-3244588 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3243186 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 675 (V675A)

Ref Sequence

ENSEMBL: ENSMUSP00000112550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000135223] [ENSMUST00000179770]

Predicted Effect

probably benign
Transcript: ENSMUST00000020734
AA Change: V826A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454
AA Change: V826A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	688	1.2e-189	PFAM
low complexity region	835	851	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110048
AA Change: V826A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454
AA Change: V826A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	688	1.2e-189	PFAM
low complexity region	835	851	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110049
AA Change: V850A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454
AA Change: V850A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	712	2.7e-184	PFAM
low complexity region	859	875	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120721
AA Change: V675A

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454
AA Change: V675A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	99	3.6e-29	PFAM
Pfam:EIF4E-T	98	327	5.1e-41	PFAM
Pfam:EIF4E-T	282	537	7.7e-30	PFAM
low complexity region	684	700	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127950

Predicted Effect

probably benign
Transcript: ENSMUST00000135223

SMART Domains

Protein: ENSMUSP00000122912
Gene: ENSMUSG00000020454

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	1	239	1.5e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147534

Predicted Effect

probably benign
Transcript: ENSMUST00000159304

SMART Domains

Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

Domain	Start	End	E-Value	Type
Pfam:TGS	13	58	5.7e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179770
AA Change: V850A

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454
AA Change: V850A

Domain	Start	End	E-Value	Type
Pfam:EIF4E-T	29	710	4.3e-160	PFAM
low complexity region	859	875	N/A	INTRINSIC

Meta Mutation Damage Score

0.0608

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.8%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,263,556		probably benign	Het
Acmsd	T	G	1: 127,749,194	L152R	probably damaging	Het
Ankle2	A	G	5: 110,244,543	K472E	possibly damaging	Het
Aup1	T	C	6: 83,055,230	V126A	probably damaging	Het
Baz1a	T	C	12: 54,911,415	Y1014C	probably damaging	Het
Bcl9	A	T	3: 97,216,368		probably benign	Het
Cnot2	A	T	10: 116,501,304	N221K	possibly damaging	Het
Col19a1	G	A	1: 24,534,052	S213L	unknown	Het
Elp3	A	G	14: 65,548,002	L450P	probably damaging	Het
Erbb4	C	T	1: 68,343,855	D328N	possibly damaging	Het
Fbll1	T	A	11: 35,797,872	H188L	possibly damaging	Het
Frem2	A	G	3: 53,539,268	F2360L	possibly damaging	Het
Gm2396	A	G	9: 88,917,662		noncoding transcript	Het
Gulo	G	T	14: 65,988,253	P375T	possibly damaging	Het
Hspd1	T	C	1: 55,086,909	M11V	probably benign	Het
Ikbkap	A	T	4: 56,755,353	N1295K	probably damaging	Het
Itgav	A	G	2: 83,768,327	T243A	probably benign	Het
Lipg	C	T	18: 74,945,831	R450H	probably damaging	Het
Lrp3	T	A	7: 35,203,410	S504C	probably damaging	Het
Mrps9	T	G	1: 42,901,094		probably benign	Het
Nlgn1	A	G	3: 25,434,392	V564A	probably damaging	Het
Ntf3	T	C	6: 126,102,175	T110A	probably benign	Het
Pkd1l1	T	A	11: 8,909,929	I560F	probably damaging	Het
Prepl	T	C	17: 85,081,154	T174A	probably benign	Het
Ptprg	A	T	14: 12,122,002	T289S	possibly damaging	Het
Rab11fip2	T	C	19: 59,935,781	T222A	probably damaging	Het
Rhbdd3	G	T	11: 5,099,460		probably benign	Het
Sept4	C	A	11: 87,588,772	D239E	probably damaging	Het
Shprh	A	G	10: 11,207,860		probably benign	Het
Slc3a1	T	A	17: 85,060,878	W525R	probably damaging	Het
Trim75	A	G	8: 64,982,764	S345P	probably damaging	Het
Usp5	C	T	6: 124,824,938	E72K	possibly damaging	Het
Vmn1r225	T	A	17: 20,502,975	M226K	probably benign	Het
Wnk4	T	A	11: 101,269,631	V697E	probably damaging	Het
Zbtb9	C	T	17: 26,973,879	T86I	probably benign	Het

Other mutations in Eif4enif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01139:Eif4enif1	APN	11	3221143	missense	probably damaging	0.96
IGL02237:Eif4enif1	APN	11	3227876	nonsense	probably null
IGL02372:Eif4enif1	APN	11	3229986	missense	probably benign	0.09
PIT4283001:Eif4enif1	UTSW	11	3234464	missense	probably damaging	1.00
R0079:Eif4enif1	UTSW	11	3242676	nonsense	probably null
R1177:Eif4enif1	UTSW	11	3229902	missense	probably damaging	1.00
R1220:Eif4enif1	UTSW	11	3239493	splice site	probably benign
R1511:Eif4enif1	UTSW	11	3236278	missense	probably benign	0.00
R1675:Eif4enif1	UTSW	11	3215686	missense	probably benign	0.02
R1908:Eif4enif1	UTSW	11	3227455	missense	probably damaging	1.00
R1940:Eif4enif1	UTSW	11	3243279	missense	probably damaging	1.00
R2173:Eif4enif1	UTSW	11	3242367	splice site	probably null
R2215:Eif4enif1	UTSW	11	3227476	missense	probably damaging	1.00
R2517:Eif4enif1	UTSW	11	3221168	missense	probably damaging	1.00
R2869:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2869:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2870:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2870:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2871:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2871:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R2873:Eif4enif1	UTSW	11	3242586	missense	probably damaging	1.00
R3147:Eif4enif1	UTSW	11	3244003	unclassified	probably null
R4195:Eif4enif1	UTSW	11	3243186	missense	possibly damaging	0.89
R4708:Eif4enif1	UTSW	11	3220323	missense	probably damaging	1.00
R4755:Eif4enif1	UTSW	11	3244016	missense	probably damaging	1.00
R5310:Eif4enif1	UTSW	11	3242687	missense	probably damaging	1.00
R5546:Eif4enif1	UTSW	11	3243989	missense	probably damaging	0.99
R5816:Eif4enif1	UTSW	11	3242401	missense	probably benign	0.13
R6018:Eif4enif1	UTSW	11	3242481	missense	probably damaging	0.97
R6036:Eif4enif1	UTSW	11	3239420	missense	probably damaging	1.00
R6036:Eif4enif1	UTSW	11	3239420	missense	probably damaging	1.00
R6267:Eif4enif1	UTSW	11	3227793	missense	probably damaging	1.00
R6514:Eif4enif1	UTSW	11	3240996	missense	probably null	0.01
R6638:Eif4enif1	UTSW	11	3242463	missense	probably damaging	0.96
R7040:Eif4enif1	UTSW	11	3234040	missense	probably benign	0.33
R7232:Eif4enif1	UTSW	11	3215678	missense	possibly damaging	0.75
R7385:Eif4enif1	UTSW	11	3220269	missense	probably damaging	1.00
R7478:Eif4enif1	UTSW	11	3227709	nonsense	probably null
R7749:Eif4enif1	UTSW	11	3242608	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGAGTCCAATCCAGTCTCACTTC -3'
(R):5'- AACCTTACCTGAGCGCTGTAG -3'

Sequencing Primer
(F):5'- TACACTAAGGAACCCTGGCTGTG -3'
(R):5'- GGTTTAGGAGAGGGTGACTA -3'

Posted On

2015-06-10