Incidental Mutation 'R4196:Septin4'
ID 318571
Institutional Source Beutler Lab
Gene Symbol Septin4
Ensembl Gene ENSMUSG00000020486
Gene Name septin 4
Synonyms Gm11492, ARTS, septin H5, cell division control-related protein 2b, Sept4, Bh5, Pnutl2
MMRRC Submission 041027-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.768) question?
Stock # R4196 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 87457515-87481365 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 87479598 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 239 (D239E)
Ref Sequence ENSEMBL: ENSMUSP00000103594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018544] [ENSMUST00000063156] [ENSMUST00000092802] [ENSMUST00000103179] [ENSMUST00000107960] [ENSMUST00000107961] [ENSMUST00000107962] [ENSMUST00000133202] [ENSMUST00000122067] [ENSMUST00000123105] [ENSMUST00000122945] [ENSMUST00000119628] [ENSMUST00000146871]
AlphaFold P28661
Q5ND19
Predicted Effect probably damaging
Transcript: ENSMUST00000018544
AA Change: D239E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018544
Gene: ENSMUSG00000020486
AA Change: D239E

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.8e-130 PFAM
Pfam:MMR_HSR1 146 290 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063156
AA Change: D140E

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000060127
Gene: ENSMUSG00000020486
AA Change: D140E

DomainStartEndE-ValueType
Pfam:DUF258 26 142 7.5e-7 PFAM
Pfam:Septin 42 322 7.5e-131 PFAM
Pfam:MMR_HSR1 47 211 5.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092802
SMART Domains Protein: ENSMUSP00000090478
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 507 4.2e-137 PFAM
low complexity region 933 945 N/A INTRINSIC
coiled coil region 961 991 N/A INTRINSIC
FYVE 1044 1113 2.08e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103179
SMART Domains Protein: ENSMUSP00000099468
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 126 521 8.1e-149 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107960
AA Change: D239E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103594
Gene: ENSMUSG00000020486
AA Change: D239E

DomainStartEndE-ValueType
low complexity region 94 108 N/A INTRINSIC
Pfam:Septin 141 421 1.1e-130 PFAM
Pfam:MMR_HSR1 146 293 7.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107961
AA Change: D133E

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103595
Gene: ENSMUSG00000020486
AA Change: D133E

DomainStartEndE-ValueType
Pfam:DUF258 19 135 1e-7 PFAM
Pfam:Septin 35 232 1.9e-89 PFAM
Pfam:MMR_HSR1 40 204 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107962
AA Change: D220E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103596
Gene: ENSMUSG00000020486
AA Change: D220E

DomainStartEndE-ValueType
low complexity region 75 89 N/A INTRINSIC
Pfam:Septin 122 402 1.3e-130 PFAM
Pfam:MMR_HSR1 127 273 8.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134923
Predicted Effect probably benign
Transcript: ENSMUST00000133202
AA Change: D229E

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115790
Gene: ENSMUSG00000020486
AA Change: D229E

DomainStartEndE-ValueType
low complexity region 84 98 N/A INTRINSIC
Pfam:DUF258 114 232 1.4e-7 PFAM
Pfam:Septin 131 280 1.2e-72 PFAM
Pfam:MMR_HSR1 136 279 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133638
Predicted Effect probably benign
Transcript: ENSMUST00000122067
AA Change: D121E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000112960
Gene: ENSMUSG00000020486
AA Change: D121E

DomainStartEndE-ValueType
Pfam:DUF258 8 124 5.3e-7 PFAM
Pfam:Septin 23 303 3.9e-131 PFAM
Pfam:MMR_HSR1 28 172 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135175
Predicted Effect probably benign
Transcript: ENSMUST00000123105
Predicted Effect probably benign
Transcript: ENSMUST00000122945
SMART Domains Protein: ENSMUSP00000115682
Gene: ENSMUSG00000020486

DomainStartEndE-ValueType
low complexity region 87 101 N/A INTRINSIC
Pfam:DUF258 116 212 2.4e-7 PFAM
Pfam:Septin 134 213 9.1e-31 PFAM
Pfam:MMR_HSR1 139 213 5.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119628
SMART Domains Protein: ENSMUSP00000112902
Gene: ENSMUSG00000018401

DomainStartEndE-ValueType
Pfam:Myotub-related 127 519 1.5e-135 PFAM
low complexity region 990 1002 N/A INTRINSIC
coiled coil region 1018 1048 N/A INTRINSIC
FYVE 1101 1170 2.08e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136229
Predicted Effect probably benign
Transcript: ENSMUST00000146871
Meta Mutation Damage Score 0.1868 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null males are sterile and have immotile and structurally defective sperm that is bent and lacks the annulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,676,931 (GRCm39) L152R probably damaging Het
Ankle2 A G 5: 110,392,409 (GRCm39) K472E possibly damaging Het
Aup1 T C 6: 83,032,211 (GRCm39) V126A probably damaging Het
Baz1a T C 12: 54,958,200 (GRCm39) Y1014C probably damaging Het
Bcl9 A T 3: 97,123,684 (GRCm39) probably benign Het
Bltp2 A G 11: 78,154,382 (GRCm39) probably benign Het
Cnot2 A T 10: 116,337,209 (GRCm39) N221K possibly damaging Het
Col19a1 G A 1: 24,573,133 (GRCm39) S213L unknown Het
Eif4enif1 T C 11: 3,193,186 (GRCm39) V675A possibly damaging Het
Elp1 A T 4: 56,755,353 (GRCm39) N1295K probably damaging Het
Elp3 A G 14: 65,785,451 (GRCm39) L450P probably damaging Het
Erbb4 C T 1: 68,383,014 (GRCm39) D328N possibly damaging Het
Fbll1 T A 11: 35,688,699 (GRCm39) H188L possibly damaging Het
Frem2 A G 3: 53,446,689 (GRCm39) F2360L possibly damaging Het
Gm2396 A G 9: 88,799,715 (GRCm39) noncoding transcript Het
Gulo G T 14: 66,225,702 (GRCm39) P375T possibly damaging Het
Hspd1 T C 1: 55,126,068 (GRCm39) M11V probably benign Het
Itgav A G 2: 83,598,671 (GRCm39) T243A probably benign Het
Lipg C T 18: 75,078,902 (GRCm39) R450H probably damaging Het
Lrp3 T A 7: 34,902,835 (GRCm39) S504C probably damaging Het
Mrps9 T G 1: 42,940,254 (GRCm39) probably benign Het
Nlgn1 A G 3: 25,488,556 (GRCm39) V564A probably damaging Het
Ntf3 T C 6: 126,079,138 (GRCm39) T110A probably benign Het
Pkd1l1 T A 11: 8,859,929 (GRCm39) I560F probably damaging Het
Prepl T C 17: 85,388,582 (GRCm39) T174A probably benign Het
Ptprg A T 14: 12,122,002 (GRCm38) T289S possibly damaging Het
Rab11fip2 T C 19: 59,924,213 (GRCm39) T222A probably damaging Het
Rhbdd3 G T 11: 5,049,460 (GRCm39) probably benign Het
Shprh A G 10: 11,083,604 (GRCm39) probably benign Het
Slc3a1 T A 17: 85,368,306 (GRCm39) W525R probably damaging Het
Trim75 A G 8: 65,435,416 (GRCm39) S345P probably damaging Het
Usp5 C T 6: 124,801,901 (GRCm39) E72K possibly damaging Het
Vmn1r225 T A 17: 20,723,237 (GRCm39) M226K probably benign Het
Wnk4 T A 11: 101,160,457 (GRCm39) V697E probably damaging Het
Zbtb9 C T 17: 27,192,853 (GRCm39) T86I probably benign Het
Other mutations in Septin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Septin4 APN 11 87,480,599 (GRCm39) missense probably damaging 1.00
IGL00963:Septin4 APN 11 87,474,199 (GRCm39) missense possibly damaging 0.89
IGL01803:Septin4 APN 11 87,459,075 (GRCm39) missense probably benign 0.07
IGL01993:Septin4 APN 11 87,458,555 (GRCm39) missense possibly damaging 0.85
IGL02566:Septin4 APN 11 87,458,468 (GRCm39) missense probably benign 0.00
IGL03087:Septin4 APN 11 87,476,071 (GRCm39) splice site probably benign
IGL03213:Septin4 APN 11 87,458,184 (GRCm39) splice site probably null
IGL03268:Septin4 APN 11 87,480,529 (GRCm39) missense probably damaging 0.99
IGL03388:Septin4 APN 11 87,459,042 (GRCm39) nonsense probably null
R0050:Septin4 UTSW 11 87,458,172 (GRCm39) missense probably damaging 1.00
R0077:Septin4 UTSW 11 87,472,022 (GRCm39) missense probably benign
R1479:Septin4 UTSW 11 87,458,244 (GRCm39) missense probably damaging 1.00
R1729:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1730:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1739:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1762:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1783:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1784:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1785:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R1851:Septin4 UTSW 11 87,459,741 (GRCm39) missense probably damaging 1.00
R1862:Septin4 UTSW 11 87,458,061 (GRCm39) missense possibly damaging 0.48
R1913:Septin4 UTSW 11 87,457,838 (GRCm39) missense probably benign
R1957:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R2131:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2133:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2140:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2141:Septin4 UTSW 11 87,474,262 (GRCm39) missense probably benign 0.26
R2252:Septin4 UTSW 11 87,480,637 (GRCm39) missense possibly damaging 0.75
R3149:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3176:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3276:Septin4 UTSW 11 87,458,070 (GRCm39) missense possibly damaging 0.46
R3696:Septin4 UTSW 11 87,476,060 (GRCm39) missense possibly damaging 0.48
R4018:Septin4 UTSW 11 87,475,947 (GRCm39) missense probably damaging 1.00
R4021:Septin4 UTSW 11 87,458,106 (GRCm39) missense probably damaging 1.00
R4117:Septin4 UTSW 11 87,459,108 (GRCm39) missense probably damaging 1.00
R4193:Septin4 UTSW 11 87,474,142 (GRCm39) critical splice acceptor site probably null
R4332:Septin4 UTSW 11 87,458,730 (GRCm39) missense possibly damaging 0.95
R4515:Septin4 UTSW 11 87,458,883 (GRCm39) missense probably benign
R4663:Septin4 UTSW 11 87,458,429 (GRCm39) missense probably damaging 0.98
R4952:Septin4 UTSW 11 87,458,598 (GRCm39) missense probably benign 0.00
R5012:Septin4 UTSW 11 87,475,230 (GRCm39) missense possibly damaging 0.78
R5015:Septin4 UTSW 11 87,458,043 (GRCm39) missense possibly damaging 0.95
R5149:Septin4 UTSW 11 87,480,071 (GRCm39) missense probably damaging 1.00
R5176:Septin4 UTSW 11 87,458,358 (GRCm39) missense probably benign 0.02
R5711:Septin4 UTSW 11 87,458,723 (GRCm39) missense probably benign 0.07
R5891:Septin4 UTSW 11 87,479,750 (GRCm39) unclassified probably benign
R6090:Septin4 UTSW 11 87,480,343 (GRCm39) missense possibly damaging 0.48
R6145:Septin4 UTSW 11 87,476,072 (GRCm39) splice site probably null
R6257:Septin4 UTSW 11 87,481,175 (GRCm39) missense probably benign 0.07
R6305:Septin4 UTSW 11 87,458,145 (GRCm39) missense probably benign 0.00
R6704:Septin4 UTSW 11 87,479,856 (GRCm39) missense probably damaging 1.00
R7064:Septin4 UTSW 11 87,481,193 (GRCm39) missense probably benign 0.02
R7090:Septin4 UTSW 11 87,475,264 (GRCm39) missense probably damaging 1.00
R7784:Septin4 UTSW 11 87,469,834 (GRCm39) missense probably benign
R7790:Septin4 UTSW 11 87,480,065 (GRCm39) missense probably damaging 1.00
R8320:Septin4 UTSW 11 87,480,560 (GRCm39) missense possibly damaging 0.68
R9289:Septin4 UTSW 11 87,459,792 (GRCm39) nonsense probably null
R9613:Septin4 UTSW 11 87,469,823 (GRCm39) missense possibly damaging 0.53
T0970:Septin4 UTSW 11 87,458,558 (GRCm39) missense probably damaging 0.98
Z1177:Septin4 UTSW 11 87,458,748 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAACTACCTGTGTACCTGTGTC -3'
(R):5'- AATCAGTGACCACCCGCTAG -3'

Sequencing Primer
(F):5'- GTCATTTTCTCTCAAGACCCGAAAC -3'
(R):5'- TAGTGGTAGCCCTGCCCTG -3'
Posted On 2015-06-10