Incidental Mutation 'R4196:Baz1a'
ID 318573
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Name bromodomain adjacent to zinc finger domain 1A
Synonyms Gtl5, Wcrf180, Acf1
MMRRC Submission 041027-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4196 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 54939774-55061133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54958200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1014 (Y1014C)
Ref Sequence ENSEMBL: ENSMUSP00000133478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
AlphaFold O88379
Predicted Effect probably damaging
Transcript: ENSMUST00000038926
AA Change: Y1017C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: Y1017C

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173433
AA Change: Y1014C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: Y1014C

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Meta Mutation Damage Score 0.7810 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acmsd T G 1: 127,676,931 (GRCm39) L152R probably damaging Het
Ankle2 A G 5: 110,392,409 (GRCm39) K472E possibly damaging Het
Aup1 T C 6: 83,032,211 (GRCm39) V126A probably damaging Het
Bcl9 A T 3: 97,123,684 (GRCm39) probably benign Het
Bltp2 A G 11: 78,154,382 (GRCm39) probably benign Het
Cnot2 A T 10: 116,337,209 (GRCm39) N221K possibly damaging Het
Col19a1 G A 1: 24,573,133 (GRCm39) S213L unknown Het
Eif4enif1 T C 11: 3,193,186 (GRCm39) V675A possibly damaging Het
Elp1 A T 4: 56,755,353 (GRCm39) N1295K probably damaging Het
Elp3 A G 14: 65,785,451 (GRCm39) L450P probably damaging Het
Erbb4 C T 1: 68,383,014 (GRCm39) D328N possibly damaging Het
Fbll1 T A 11: 35,688,699 (GRCm39) H188L possibly damaging Het
Frem2 A G 3: 53,446,689 (GRCm39) F2360L possibly damaging Het
Gm2396 A G 9: 88,799,715 (GRCm39) noncoding transcript Het
Gulo G T 14: 66,225,702 (GRCm39) P375T possibly damaging Het
Hspd1 T C 1: 55,126,068 (GRCm39) M11V probably benign Het
Itgav A G 2: 83,598,671 (GRCm39) T243A probably benign Het
Lipg C T 18: 75,078,902 (GRCm39) R450H probably damaging Het
Lrp3 T A 7: 34,902,835 (GRCm39) S504C probably damaging Het
Mrps9 T G 1: 42,940,254 (GRCm39) probably benign Het
Nlgn1 A G 3: 25,488,556 (GRCm39) V564A probably damaging Het
Ntf3 T C 6: 126,079,138 (GRCm39) T110A probably benign Het
Pkd1l1 T A 11: 8,859,929 (GRCm39) I560F probably damaging Het
Prepl T C 17: 85,388,582 (GRCm39) T174A probably benign Het
Ptprg A T 14: 12,122,002 (GRCm38) T289S possibly damaging Het
Rab11fip2 T C 19: 59,924,213 (GRCm39) T222A probably damaging Het
Rhbdd3 G T 11: 5,049,460 (GRCm39) probably benign Het
Septin4 C A 11: 87,479,598 (GRCm39) D239E probably damaging Het
Shprh A G 10: 11,083,604 (GRCm39) probably benign Het
Slc3a1 T A 17: 85,368,306 (GRCm39) W525R probably damaging Het
Trim75 A G 8: 65,435,416 (GRCm39) S345P probably damaging Het
Usp5 C T 6: 124,801,901 (GRCm39) E72K possibly damaging Het
Vmn1r225 T A 17: 20,723,237 (GRCm39) M226K probably benign Het
Wnk4 T A 11: 101,160,457 (GRCm39) V697E probably damaging Het
Zbtb9 C T 17: 27,192,853 (GRCm39) T86I probably benign Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54,963,516 (GRCm39) missense probably benign
IGL01138:Baz1a APN 12 54,977,110 (GRCm39) missense probably damaging 1.00
IGL01298:Baz1a APN 12 55,001,594 (GRCm39) missense probably damaging 1.00
IGL02639:Baz1a APN 12 54,942,810 (GRCm39) splice site probably benign
IGL02995:Baz1a APN 12 54,947,232 (GRCm39) missense probably damaging 1.00
IGL03001:Baz1a APN 12 54,969,896 (GRCm39) missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54,941,743 (GRCm39) missense probably damaging 1.00
IGL03135:Baz1a APN 12 54,976,375 (GRCm39) missense probably damaging 1.00
IGL03151:Baz1a APN 12 54,955,934 (GRCm39) critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54,945,320 (GRCm39) missense probably damaging 1.00
IGL03240:Baz1a APN 12 54,974,352 (GRCm39) nonsense probably null
Bezos UTSW 12 54,941,816 (GRCm39) nonsense probably null
Flavia UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
gumdrops UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
Kilter UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
Kisses UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
liverlips UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
smooch UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
Smootch UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54,977,095 (GRCm39) missense probably benign 0.03
R0127:Baz1a UTSW 12 54,945,491 (GRCm39) missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54,958,172 (GRCm39) missense probably damaging 1.00
R0393:Baz1a UTSW 12 54,965,221 (GRCm39) critical splice donor site probably null
R0532:Baz1a UTSW 12 54,981,605 (GRCm39) missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54,988,304 (GRCm39) nonsense probably null
R0626:Baz1a UTSW 12 55,022,055 (GRCm39) missense probably damaging 0.99
R0654:Baz1a UTSW 12 54,958,182 (GRCm39) missense probably benign 0.01
R0782:Baz1a UTSW 12 54,941,273 (GRCm39) missense probably damaging 1.00
R0826:Baz1a UTSW 12 54,977,097 (GRCm39) nonsense probably null
R0855:Baz1a UTSW 12 54,947,348 (GRCm39) splice site probably benign
R0927:Baz1a UTSW 12 54,941,773 (GRCm39) missense probably damaging 1.00
R0941:Baz1a UTSW 12 54,945,216 (GRCm39) missense probably benign 0.00
R1079:Baz1a UTSW 12 54,941,785 (GRCm39) missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54,976,349 (GRCm39) missense probably damaging 1.00
R1647:Baz1a UTSW 12 55,021,983 (GRCm39) missense probably damaging 1.00
R1731:Baz1a UTSW 12 54,965,330 (GRCm39) missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54,945,573 (GRCm39) nonsense probably null
R1762:Baz1a UTSW 12 54,955,805 (GRCm39) missense probably damaging 1.00
R1770:Baz1a UTSW 12 54,945,293 (GRCm39) missense probably damaging 1.00
R1968:Baz1a UTSW 12 54,947,122 (GRCm39) missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54,976,431 (GRCm39) missense probably damaging 1.00
R2111:Baz1a UTSW 12 54,958,170 (GRCm39) missense probably damaging 1.00
R2215:Baz1a UTSW 12 55,022,154 (GRCm39) nonsense probably null
R2282:Baz1a UTSW 12 54,963,597 (GRCm39) nonsense probably null
R2875:Baz1a UTSW 12 54,969,904 (GRCm39) missense probably damaging 1.00
R2890:Baz1a UTSW 12 54,945,302 (GRCm39) missense probably benign
R2971:Baz1a UTSW 12 54,970,224 (GRCm39) missense probably damaging 1.00
R3404:Baz1a UTSW 12 54,963,774 (GRCm39) missense probably benign 0.00
R3419:Baz1a UTSW 12 54,993,684 (GRCm39) missense probably benign 0.05
R3699:Baz1a UTSW 12 54,963,831 (GRCm39) missense probably benign 0.09
R3899:Baz1a UTSW 12 54,981,589 (GRCm39) missense probably benign 0.01
R3927:Baz1a UTSW 12 54,967,928 (GRCm39) missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54,976,404 (GRCm39) missense probably benign 0.00
R4072:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R4289:Baz1a UTSW 12 54,947,233 (GRCm39) missense probably damaging 1.00
R4455:Baz1a UTSW 12 54,958,153 (GRCm39) missense probably benign 0.26
R4583:Baz1a UTSW 12 54,969,325 (GRCm39) missense probably damaging 0.99
R4622:Baz1a UTSW 12 54,988,300 (GRCm39) missense probably benign 0.00
R4807:Baz1a UTSW 12 54,945,267 (GRCm39) missense probably benign 0.28
R4998:Baz1a UTSW 12 55,021,922 (GRCm39) missense probably damaging 1.00
R5239:Baz1a UTSW 12 54,945,129 (GRCm39) missense probably damaging 0.99
R5379:Baz1a UTSW 12 54,941,133 (GRCm39) missense probably damaging 1.00
R5408:Baz1a UTSW 12 54,969,835 (GRCm39) missense probably damaging 1.00
R5678:Baz1a UTSW 12 54,947,317 (GRCm39) missense probably damaging 0.99
R5810:Baz1a UTSW 12 54,974,500 (GRCm39) intron probably benign
R6092:Baz1a UTSW 12 54,955,868 (GRCm39) missense possibly damaging 0.88
R6317:Baz1a UTSW 12 55,001,585 (GRCm39) missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54,965,339 (GRCm39) missense probably benign 0.01
R6803:Baz1a UTSW 12 54,988,340 (GRCm39) missense probably null 0.99
R7185:Baz1a UTSW 12 55,022,093 (GRCm39) missense probably damaging 1.00
R7248:Baz1a UTSW 12 54,947,293 (GRCm39) missense probably damaging 1.00
R7392:Baz1a UTSW 12 54,945,550 (GRCm39) missense probably damaging 1.00
R8009:Baz1a UTSW 12 54,941,816 (GRCm39) nonsense probably null
R8025:Baz1a UTSW 12 54,955,921 (GRCm39) missense probably benign 0.34
R8392:Baz1a UTSW 12 54,969,908 (GRCm39) missense probably damaging 1.00
R8862:Baz1a UTSW 12 55,032,624 (GRCm39) unclassified probably benign
R8949:Baz1a UTSW 12 54,941,238 (GRCm39) missense probably damaging 1.00
R9340:Baz1a UTSW 12 54,963,372 (GRCm39) missense probably damaging 0.97
R9389:Baz1a UTSW 12 54,963,608 (GRCm39) missense probably damaging 1.00
R9401:Baz1a UTSW 12 54,963,339 (GRCm39) missense probably damaging 1.00
R9666:Baz1a UTSW 12 54,988,345 (GRCm39) missense probably benign 0.18
R9722:Baz1a UTSW 12 54,946,882 (GRCm39) missense probably benign 0.43
R9746:Baz1a UTSW 12 55,021,895 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAAGGATGAGAGATACTGACTTCTG -3'
(R):5'- TATAACCCTGGCTTGCCTGC -3'

Sequencing Primer
(F):5'- GGCTATCCAGGAACTCACTCTGTAG -3'
(R):5'- CAGGGTCATTAACTTTAGGT -3'
Posted On 2015-06-10