Incidental Mutation 'R4197:Rad23b'
ID318588
Institutional Source Beutler Lab
Gene Symbol Rad23b
Ensembl Gene ENSMUSG00000028426
Gene NameRAD23 homolog B, nucleotide excision repair protein
Synonyms0610007D13Rik, mHR23B
MMRRC Submission 041028-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4197 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location55350043-55392237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55385455 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 331 (P331S)
Ref Sequence ENSEMBL: ENSMUSP00000030134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030134]
PDB Structure
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000030134
AA Change: P331S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030134
Gene: ENSMUSG00000028426
AA Change: P331S

DomainStartEndE-ValueType
UBQ 1 75 8.79e-24 SMART
low complexity region 79 143 N/A INTRINSIC
UBA 190 227 3.1e-11 SMART
low complexity region 257 270 N/A INTRINSIC
STI1 274 317 3.37e-10 SMART
UBA 373 410 6.35e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156263
Meta Mutation Damage Score 0.3218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene usually die around the time of birth. Those that survive show growth retardation, eye, reproductive, behavioral, and digestive system abnormalities. They usually die within 1 year of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik G A 11: 103,201,140 S94L probably benign Het
BC049730 A G 7: 24,713,694 D146G probably benign Het
Ccno G A 13: 112,989,069 C189Y probably damaging Het
Cd36 T A 5: 17,813,088 D209V probably damaging Het
Depdc5 T A 5: 32,991,203 L1561Q possibly damaging Het
Dhx34 G T 7: 16,203,726 H777N probably damaging Het
Dlat T C 9: 50,636,526 T610A probably damaging Het
Fip1l1 T A 5: 74,535,736 D19E probably damaging Het
Gm5699 T A 1: 30,998,645 noncoding transcript Het
Grin2a A C 16: 9,761,967 F144C probably damaging Het
Klhl18 A T 9: 110,429,944 probably null Het
Klhl31 T C 9: 77,650,809 V269A probably damaging Het
Mmel1 T C 4: 154,893,304 I594T probably damaging Het
Myo9a T A 9: 59,894,866 S1913T probably benign Het
Olfr2 T C 7: 107,001,038 D274G probably damaging Het
Pcdhb14 A G 18: 37,448,305 K155E probably benign Het
Pdcd10 A T 3: 75,517,592 N189K possibly damaging Het
Pde3b T G 7: 114,530,872 probably benign Het
Plxnb2 T C 15: 89,157,018 N1775S probably damaging Het
Polr2a T C 11: 69,735,336 S1625G unknown Het
Ptpn21 G T 12: 98,680,138 H1020Q probably damaging Het
Scel A T 14: 103,599,400 N475Y probably damaging Het
Sema5a A G 15: 32,618,918 T531A probably benign Het
Sf3b3 A T 8: 110,821,565 L679Q probably damaging Het
Sipa1l3 A T 7: 29,400,813 D10E possibly damaging Het
Slc44a4 G A 17: 34,918,252 V84I probably benign Het
Slco5a1 G T 1: 12,894,516 S512R probably damaging Het
Sv2c A T 13: 95,978,128 F517I probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tnfsf11 A T 14: 78,284,312 D152E probably benign Het
Trav13n-4 C T 14: 53,363,921 T49I probably benign Het
Ttn T C 2: 76,886,078 probably benign Het
Usp34 T C 11: 23,444,189 S2261P probably damaging Het
Vmn2r87 G A 10: 130,479,910 P96S possibly damaging Het
Xrcc6 A G 15: 82,029,224 M353V probably benign Het
Other mutations in Rad23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Rad23b APN 4 55366774 splice site probably benign
IGL01326:Rad23b APN 4 55383601 missense possibly damaging 0.95
IGL02398:Rad23b APN 4 55350360 utr 5 prime probably benign
IGL02506:Rad23b APN 4 55382511 missense probably benign 0.01
IGL02538:Rad23b APN 4 55370457 missense possibly damaging 0.67
Saguaro UTSW 4 55370474 critical splice donor site probably null
R0278:Rad23b UTSW 4 55383575 splice site probably null
R1846:Rad23b UTSW 4 55383637 nonsense probably null
R2198:Rad23b UTSW 4 55385497 missense possibly damaging 0.68
R2425:Rad23b UTSW 4 55385438 missense probably damaging 0.99
R3774:Rad23b UTSW 4 55382589 missense possibly damaging 0.95
R3781:Rad23b UTSW 4 55382586 missense probably damaging 1.00
R5911:Rad23b UTSW 4 55370474 critical splice donor site probably null
R6056:Rad23b UTSW 4 55382540 missense probably benign 0.01
R6067:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6078:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6079:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R7426:Rad23b UTSW 4 55370469 missense probably benign 0.00
U15987:Rad23b UTSW 4 55370400 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCATTTACCTTTCAGAACTGTTGTG -3'
(R):5'- TGGTAGCAGGAGCCACTAG -3'

Sequencing Primer
(F):5'- TATGACTCAGCCATGCCTAAGATG -3'
(R):5'- AGCCACTAGCCCAGGTG -3'
Posted On2015-06-10