Incidental Mutation 'R4197:Slc44a4'
ID318616
Institutional Source Beutler Lab
Gene Symbol Slc44a4
Ensembl Gene ENSMUSG00000007034
Gene Namesolute carrier family 44, member 4
Synonyms2210409B01Rik, NG22
MMRRC Submission 041028-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4197 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34914466-34930436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34918252 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 84 (V84I)
Ref Sequence ENSEMBL: ENSMUSP00000007249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000013931] [ENSMUST00000078061] [ENSMUST00000097342] [ENSMUST00000114033] [ENSMUST00000137071] [ENSMUST00000169230]
Predicted Effect probably benign
Transcript: ENSMUST00000007249
AA Change: V84I

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034
AA Change: V84I

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000013931
SMART Domains Protein: ENSMUSP00000013931
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 604 627 N/A INTRINSIC
ANK 737 766 2.52e-6 SMART
ANK 770 799 1.19e-2 SMART
ANK 803 833 4.71e-6 SMART
ANK 837 866 2.9e-6 SMART
ANK 870 899 1e0 SMART
ANK 903 932 1.53e-5 SMART
PreSET 976 1075 2.44e-40 SMART
SET 1091 1214 4.08e-46 SMART
PostSET 1217 1233 2.84e-1 SMART
low complexity region 1245 1260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078061
SMART Domains Protein: ENSMUSP00000077208
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
ANK 646 675 2.52e-6 SMART
ANK 679 708 1.19e-2 SMART
ANK 712 742 4.71e-6 SMART
ANK 746 775 2.9e-6 SMART
ANK 779 808 1e0 SMART
ANK 812 841 1.53e-5 SMART
PreSET 885 984 2.44e-40 SMART
SET 1000 1123 4.08e-46 SMART
PostSET 1126 1142 2.84e-1 SMART
low complexity region 1154 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097342
SMART Domains Protein: ENSMUSP00000094955
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
ANK 703 732 2.52e-6 SMART
ANK 736 765 1.19e-2 SMART
ANK 769 799 4.71e-6 SMART
ANK 803 832 2.9e-6 SMART
ANK 836 865 1e0 SMART
ANK 869 898 1.53e-5 SMART
PreSET 942 1041 2.44e-40 SMART
SET 1057 1180 4.08e-46 SMART
PostSET 1183 1199 2.84e-1 SMART
low complexity region 1211 1226 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114033
SMART Domains Protein: ENSMUSP00000109667
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
ANK 680 709 2.52e-6 SMART
ANK 713 742 1.19e-2 SMART
ANK 746 776 4.71e-6 SMART
ANK 780 809 2.9e-6 SMART
ANK 813 842 1e0 SMART
ANK 846 875 1.53e-5 SMART
PreSET 919 1018 2.44e-40 SMART
SET 1034 1157 4.08e-46 SMART
PostSET 1160 1176 2.84e-1 SMART
low complexity region 1188 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124002
Predicted Effect probably benign
Transcript: ENSMUST00000137071
SMART Domains Protein: ENSMUSP00000134749
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
ANK 23 52 1.19e-2 SMART
ANK 56 86 4.71e-6 SMART
ANK 90 119 2.9e-6 SMART
low complexity region 143 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169230
SMART Domains Protein: ENSMUSP00000132965
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 74 96 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
Pfam:Choline_transpo 157 524 3.9e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173664
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be a sodium-dependent transmembrane transport protein involved in the uptake of choline by cholinergic neurons. Defects in this gene can cause sialidosis, a lysosomal storage disease. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik G A 11: 103,201,140 S94L probably benign Het
BC049730 A G 7: 24,713,694 D146G probably benign Het
Ccno G A 13: 112,989,069 C189Y probably damaging Het
Cd36 T A 5: 17,813,088 D209V probably damaging Het
Depdc5 T A 5: 32,991,203 L1561Q possibly damaging Het
Dhx34 G T 7: 16,203,726 H777N probably damaging Het
Dlat T C 9: 50,636,526 T610A probably damaging Het
Fip1l1 T A 5: 74,535,736 D19E probably damaging Het
Gm5699 T A 1: 30,998,645 noncoding transcript Het
Grin2a A C 16: 9,761,967 F144C probably damaging Het
Klhl18 A T 9: 110,429,944 probably null Het
Klhl31 T C 9: 77,650,809 V269A probably damaging Het
Mmel1 T C 4: 154,893,304 I594T probably damaging Het
Myo9a T A 9: 59,894,866 S1913T probably benign Het
Olfr2 T C 7: 107,001,038 D274G probably damaging Het
Pcdhb14 A G 18: 37,448,305 K155E probably benign Het
Pdcd10 A T 3: 75,517,592 N189K possibly damaging Het
Pde3b T G 7: 114,530,872 probably benign Het
Plxnb2 T C 15: 89,157,018 N1775S probably damaging Het
Polr2a T C 11: 69,735,336 S1625G unknown Het
Ptpn21 G T 12: 98,680,138 H1020Q probably damaging Het
Rad23b C T 4: 55,385,455 P331S probably damaging Het
Scel A T 14: 103,599,400 N475Y probably damaging Het
Sema5a A G 15: 32,618,918 T531A probably benign Het
Sf3b3 A T 8: 110,821,565 L679Q probably damaging Het
Sipa1l3 A T 7: 29,400,813 D10E possibly damaging Het
Slco5a1 G T 1: 12,894,516 S512R probably damaging Het
Sv2c A T 13: 95,978,128 F517I probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tnfsf11 A T 14: 78,284,312 D152E probably benign Het
Trav13n-4 C T 14: 53,363,921 T49I probably benign Het
Ttn T C 2: 76,886,078 probably benign Het
Usp34 T C 11: 23,444,189 S2261P probably damaging Het
Vmn2r87 G A 10: 130,479,910 P96S possibly damaging Het
Xrcc6 A G 15: 82,029,224 M353V probably benign Het
Other mutations in Slc44a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Slc44a4 APN 17 34930240 utr 3 prime probably benign
IGL01097:Slc44a4 APN 17 34921569 missense probably damaging 0.97
IGL01296:Slc44a4 APN 17 34921698 missense probably benign 0.39
IGL01606:Slc44a4 APN 17 34929018 missense probably damaging 1.00
IGL01759:Slc44a4 APN 17 34921243 missense probably benign 0.00
IGL02026:Slc44a4 APN 17 34921856 splice site probably benign
IGL02119:Slc44a4 APN 17 34928661 missense probably damaging 1.00
IGL02338:Slc44a4 APN 17 34923810 missense possibly damaging 0.90
IGL02383:Slc44a4 APN 17 34927710 missense probably benign 0.00
IGL02526:Slc44a4 APN 17 34928487 missense probably damaging 0.99
IGL02744:Slc44a4 APN 17 34927800 missense probably damaging 1.00
IGL02754:Slc44a4 APN 17 34921303 missense probably damaging 0.98
ANU74:Slc44a4 UTSW 17 34921578 missense probably damaging 1.00
PIT4142001:Slc44a4 UTSW 17 34921275 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0007:Slc44a4 UTSW 17 34921254 missense probably damaging 0.99
R0452:Slc44a4 UTSW 17 34928095 missense possibly damaging 0.82
R0894:Slc44a4 UTSW 17 34928490 missense possibly damaging 0.92
R1136:Slc44a4 UTSW 17 34928022 missense probably damaging 1.00
R1224:Slc44a4 UTSW 17 34921868 missense probably benign 0.18
R1779:Slc44a4 UTSW 17 34921925 missense probably damaging 1.00
R2679:Slc44a4 UTSW 17 34923423 splice site probably benign
R3499:Slc44a4 UTSW 17 34921680 missense probably benign 0.02
R3732:Slc44a4 UTSW 17 34921561 synonymous silent
R4084:Slc44a4 UTSW 17 34917347 missense probably damaging 1.00
R4536:Slc44a4 UTSW 17 34923839 missense probably damaging 1.00
R4547:Slc44a4 UTSW 17 34927755 missense probably damaging 1.00
R5093:Slc44a4 UTSW 17 34921243 missense probably benign 0.00
R6005:Slc44a4 UTSW 17 34923454 missense possibly damaging 0.69
R6396:Slc44a4 UTSW 17 34928884 nonsense probably null
R6660:Slc44a4 UTSW 17 34930225 missense probably damaging 0.99
R6860:Slc44a4 UTSW 17 34921068 missense probably damaging 1.00
R6863:Slc44a4 UTSW 17 34923822 missense probably benign 0.41
R6947:Slc44a4 UTSW 17 34928068 missense probably null 1.00
R7250:Slc44a4 UTSW 17 34918544 critical splice donor site probably null
R7297:Slc44a4 UTSW 17 34927912 missense probably damaging 0.98
R7425:Slc44a4 UTSW 17 34921691 missense possibly damaging 0.94
R7696:Slc44a4 UTSW 17 34928700 missense probably damaging 1.00
R7871:Slc44a4 UTSW 17 34923852 critical splice donor site probably null
R7954:Slc44a4 UTSW 17 34923852 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTAGAGGGTTGTGTTCCAGAAC -3'
(R):5'- CCTGTGGGTAGAGAACATGC -3'

Sequencing Primer
(F):5'- ATACTGTCAGCCGCACATTGG -3'
(R):5'- CATGCTAAGGGCCTAGTACC -3'
Posted On2015-06-10