Incidental Mutation 'R4198:Lnpk'
ID318622
Institutional Source Beutler Lab
Gene Symbol Lnpk
Ensembl Gene ENSMUSG00000009207
Gene Namelunapark, ER junction formation factor
Synonyms2310011O18Rik, lunapark, 9530051D01Rik, 4921514L11Rik
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location74520291-74579435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74569109 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 30 (E30G)
Ref Sequence ENSEMBL: ENSMUSP00000123058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064503] [ENSMUST00000102676] [ENSMUST00000111993] [ENSMUST00000130232] [ENSMUST00000130586] [ENSMUST00000134168]
Predicted Effect probably damaging
Transcript: ENSMUST00000064503
AA Change: E30G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066891
Gene: ENSMUSG00000009207
AA Change: E30G

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 198 N/A INTRINSIC
low complexity region 228 245 N/A INTRINSIC
Pfam:zinc_ribbon_10 250 300 7.4e-25 PFAM
low complexity region 383 401 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102676
AA Change: E30G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099737
Gene: ENSMUSG00000009207
AA Change: E30G

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 198 N/A INTRINSIC
low complexity region 228 245 N/A INTRINSIC
Pfam:DUF2296 250 300 2.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111993
AA Change: E30G

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107624
Gene: ENSMUSG00000009207
AA Change: E30G

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 198 N/A INTRINSIC
low complexity region 228 245 N/A INTRINSIC
Pfam:DUF2296 250 300 2.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130232
AA Change: E30G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120494
Gene: ENSMUSG00000009207
AA Change: E30G

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130586
AA Change: E30G

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122488
Gene: ENSMUSG00000009207
AA Change: E30G

DomainStartEndE-ValueType
coiled coil region 15 41 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
coiled coil region 100 129 N/A INTRINSIC
low complexity region 177 198 N/A INTRINSIC
low complexity region 228 245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134168
AA Change: E30G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154706
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: A semidominant X-ray-induced mutation results in severe length reductions of forelimb and hindlimb zeugopods, near absence of ulna, abnormal articulations in the carpus and tarsus, and genetic background-sensitive postnatal survival; heterozygous males do not breed and show increased bleeding times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Lnpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Lnpk APN 2 74529717 missense probably damaging 1.00
IGL02653:Lnpk APN 2 74548048 missense probably damaging 1.00
R0173:Lnpk UTSW 2 74551065 missense probably damaging 1.00
R0242:Lnpk UTSW 2 74537289 splice site probably benign
R1579:Lnpk UTSW 2 74547996 missense probably damaging 1.00
R2192:Lnpk UTSW 2 74569029 missense probably benign 0.13
R2698:Lnpk UTSW 2 74537501 missense probably damaging 1.00
R3788:Lnpk UTSW 2 74522263 missense probably benign 0.00
R3789:Lnpk UTSW 2 74522263 missense probably benign 0.00
R3790:Lnpk UTSW 2 74522263 missense probably benign 0.00
R4547:Lnpk UTSW 2 74522286 missense probably benign 0.14
R5244:Lnpk UTSW 2 74531888 missense probably damaging 1.00
R5347:Lnpk UTSW 2 74573591 start gained probably benign
R5516:Lnpk UTSW 2 74547788 intron probably benign
R5610:Lnpk UTSW 2 74548025 missense probably benign 0.02
R5859:Lnpk UTSW 2 74569028 missense possibly damaging 0.93
R5984:Lnpk UTSW 2 74522199 missense probably benign 0.00
R6788:Lnpk UTSW 2 74529676 missense probably benign 0.02
R7597:Lnpk UTSW 2 74568972 missense probably benign 0.28
R8062:Lnpk UTSW 2 74551063 missense possibly damaging 0.90
R8103:Lnpk UTSW 2 74522255 missense probably benign 0.10
Z1177:Lnpk UTSW 2 74573562 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATATCCTTTGGGCTATAAAGTAG -3'
(R):5'- AGTCTTTGGCAATAGACTGATAGAC -3'

Sequencing Primer
(F):5'- tCTGGTCAAAAAAGAAAAAGATC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2015-06-10