Incidental Mutation 'R4198:Kirrel'
ID318623
Institutional Source Beutler Lab
Gene Symbol Kirrel
Ensembl Gene ENSMUSG00000041734
Gene Namekirre like nephrin family adhesion molecule 1
SynonymsKirrel1, 6720469N11Rik, Neph1
MMRRC Submission 041640-MU
Accession Numbers

Genbank: NM_130867; MGI: 1891396

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87078593-87174747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87089151 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 380 (M380I)
Ref Sequence ENSEMBL: ENSMUSP00000125525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]
Predicted Effect probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

DomainStartEndE-ValueType
IG 59 149 3.62e-10 SMART
IG_like 160 252 1.27e1 SMART
IG_like 261 337 1.89e1 SMART
IGc2 352 410 3.28e-8 SMART
IG_like 430 522 5.71e0 SMART
transmembrane domain 529 551 N/A INTRINSIC
low complexity region 694 712 N/A INTRINSIC
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]
Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Kirrel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Kirrel APN 3 87089875 missense probably benign 0.22
IGL01865:Kirrel APN 3 87086424 missense probably damaging 1.00
IGL01875:Kirrel APN 3 87095730 missense probably damaging 1.00
IGL02337:Kirrel APN 3 87089212 missense possibly damaging 0.64
IGL02724:Kirrel APN 3 87090473 nonsense probably null
IGL02825:Kirrel APN 3 87089288 splice site probably benign
IGL02826:Kirrel APN 3 87088485 missense probably damaging 1.00
IGL03102:Kirrel APN 3 87083500 missense probably damaging 0.98
D4043:Kirrel UTSW 3 87083203 missense probably benign 0.02
R0360:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0364:Kirrel UTSW 3 87089799 missense probably damaging 1.00
R0421:Kirrel UTSW 3 87083607 missense probably damaging 0.99
R0503:Kirrel UTSW 3 87097802 missense probably benign 0.20
R1112:Kirrel UTSW 3 87089151 missense probably null 0.46
R1116:Kirrel UTSW 3 87089151 missense probably null 0.46
R1144:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1147:Kirrel UTSW 3 87089151 missense probably null 0.46
R1190:Kirrel UTSW 3 87089151 missense probably null 0.46
R1226:Kirrel UTSW 3 87089151 missense probably null 0.46
R1501:Kirrel UTSW 3 87090472 missense probably benign 0.02
R1538:Kirrel UTSW 3 87089151 missense probably null 0.46
R1546:Kirrel UTSW 3 87089151 missense probably null 0.46
R1628:Kirrel UTSW 3 87089151 missense probably null 0.46
R1630:Kirrel UTSW 3 87089151 missense probably null 0.46
R1631:Kirrel UTSW 3 87089151 missense probably null 0.46
R1664:Kirrel UTSW 3 87089151 missense probably null 0.46
R1671:Kirrel UTSW 3 87089151 missense probably null 0.46
R1695:Kirrel UTSW 3 87089151 missense probably null 0.46
R1769:Kirrel UTSW 3 87089151 missense probably null 0.46
R1807:Kirrel UTSW 3 87089151 missense probably null 0.46
R1808:Kirrel UTSW 3 87089151 missense probably null 0.46
R1840:Kirrel UTSW 3 87089151 missense probably null 0.46
R1876:Kirrel UTSW 3 87089151 missense probably null 0.46
R1995:Kirrel UTSW 3 87095786 missense possibly damaging 0.88
R2014:Kirrel UTSW 3 87089151 missense probably null 0.46
R2086:Kirrel UTSW 3 87089151 missense probably null 0.46
R2108:Kirrel UTSW 3 87089151 missense probably null 0.46
R2354:Kirrel UTSW 3 87088485 missense probably damaging 0.98
R2407:Kirrel UTSW 3 87084843 missense probably benign 0.03
R2904:Kirrel UTSW 3 87089151 missense probably null 0.46
R2905:Kirrel UTSW 3 87089151 missense probably null 0.46
R2958:Kirrel UTSW 3 87089151 missense probably null 0.46
R2959:Kirrel UTSW 3 87089151 missense probably null 0.46
R2960:Kirrel UTSW 3 87089151 missense probably null 0.46
R2961:Kirrel UTSW 3 87089151 missense probably null 0.46
R3026:Kirrel UTSW 3 87089151 missense probably null 0.46
R3028:Kirrel UTSW 3 87089151 missense probably null 0.46
R3034:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R3149:Kirrel UTSW 3 87089151 missense probably null 0.46
R3195:Kirrel UTSW 3 87089151 missense probably null 0.46
R3196:Kirrel UTSW 3 87089151 missense probably null 0.46
R3499:Kirrel UTSW 3 87089151 missense probably null 0.46
R3699:Kirrel UTSW 3 87089151 missense probably null 0.46
R3720:Kirrel UTSW 3 87089151 missense probably null 0.46
R3721:Kirrel UTSW 3 87089151 missense probably null 0.46
R3788:Kirrel UTSW 3 87089151 missense probably null 0.46
R3793:Kirrel UTSW 3 87089151 missense probably null 0.46
R3876:Kirrel UTSW 3 87089151 missense probably null 0.46
R3877:Kirrel UTSW 3 87089151 missense probably null 0.46
R3901:Kirrel UTSW 3 87089151 missense probably null 0.46
R3910:Kirrel UTSW 3 87089151 missense probably null 0.46
R3911:Kirrel UTSW 3 87089151 missense probably null 0.46
R3912:Kirrel UTSW 3 87089151 missense probably null 0.46
R3913:Kirrel UTSW 3 87089151 missense probably null 0.46
R3930:Kirrel UTSW 3 87089151 missense probably null 0.46
R3931:Kirrel UTSW 3 87089151 missense probably null 0.46
R4022:Kirrel UTSW 3 87089151 missense probably null 0.46
R4067:Kirrel UTSW 3 87088467 nonsense probably null
R4077:Kirrel UTSW 3 87085080 critical splice donor site probably null
R4328:Kirrel UTSW 3 87084774 intron probably benign
R4355:Kirrel UTSW 3 87089151 missense probably null 0.46
R4363:Kirrel UTSW 3 87090485 nonsense probably null
R4378:Kirrel UTSW 3 87089151 missense probably null 0.46
R4386:Kirrel UTSW 3 87089151 missense probably null 0.46
R4460:Kirrel UTSW 3 87089151 missense probably null 0.46
R4468:Kirrel UTSW 3 87089151 missense probably null 0.46
R4469:Kirrel UTSW 3 87089151 missense probably null 0.46
R4650:Kirrel UTSW 3 87089151 missense probably null 0.46
R4652:Kirrel UTSW 3 87089151 missense probably null 0.46
R4734:Kirrel UTSW 3 87089151 missense probably null 0.46
R4748:Kirrel UTSW 3 87089151 missense probably null 0.46
R4749:Kirrel UTSW 3 87089151 missense probably null 0.46
R5304:Kirrel UTSW 3 87089595 missense probably benign 0.02
R5534:Kirrel UTSW 3 87090518 missense probably damaging 1.00
R5604:Kirrel UTSW 3 87089155 missense possibly damaging 0.69
R7199:Kirrel UTSW 3 87083388 missense probably benign 0.02
R7221:Kirrel UTSW 3 87086397 nonsense probably null
R7284:Kirrel UTSW 3 87083387 missense probably benign 0.02
R7332:Kirrel UTSW 3 87088398 missense probably benign 0.14
R7369:Kirrel UTSW 3 87141084 missense probably benign 0.20
R7371:Kirrel UTSW 3 87088422 missense probably benign 0.44
R7508:Kirrel UTSW 3 87083439 missense possibly damaging 0.56
R7566:Kirrel UTSW 3 87088484 missense probably damaging 1.00
R7567:Kirrel UTSW 3 87095681 missense probably damaging 0.99
R7621:Kirrel UTSW 3 87088221 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACCCTGAGTTCTATGCAAGTCC -3'
(R):5'- AGCTGATGATTCTCAGGCAC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'
Posted On2015-06-10