Incidental Mutation 'R4198:Zfp316'
ID318627
Institutional Source Beutler Lab
Gene Symbol Zfp316
Ensembl Gene ENSMUSG00000046658
Gene Namezinc finger protein 316
SynonymsEmzf1
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location143249697-143270022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143254471 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 598 (M598V)
Ref Sequence ENSEMBL: ENSMUSP00000125416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051665] [ENSMUST00000161448]
Predicted Effect probably benign
Transcript: ENSMUST00000051665
AA Change: M598V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059418
Gene: ENSMUSG00000046658
AA Change: M598V

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161448
AA Change: M598V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125416
Gene: ENSMUSG00000046658
AA Change: M598V

DomainStartEndE-ValueType
low complexity region 30 68 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
KRAB 155 215 4.31e-37 SMART
low complexity region 239 262 N/A INTRINSIC
ZnF_C2H2 341 363 1.58e-3 SMART
ZnF_C2H2 369 391 1.45e-2 SMART
ZnF_C2H2 397 419 6.88e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.2e-3 SMART
ZnF_C2H2 481 501 2.17e1 SMART
low complexity region 524 558 N/A INTRINSIC
low complexity region 568 584 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
ZnF_C2H2 708 730 1.2e-3 SMART
ZnF_C2H2 736 758 3.58e-2 SMART
ZnF_C2H2 764 786 1.45e-2 SMART
ZnF_C2H2 792 814 1.99e0 SMART
ZnF_C2H2 820 842 2.82e0 SMART
ZnF_C2H2 848 870 7.9e-4 SMART
ZnF_C2H2 876 898 1.45e-2 SMART
ZnF_C2H2 904 926 9.88e-5 SMART
ZnF_C2H2 932 954 2.09e-3 SMART
low complexity region 964 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197349
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Zfp316
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Zfp316 APN 5 143254426 missense probably benign 0.00
IGL01783:Zfp316 APN 5 143262876 missense unknown
R0415:Zfp316 UTSW 5 143264491 missense unknown
R0423:Zfp316 UTSW 5 143253238 missense probably damaging 0.98
R1576:Zfp316 UTSW 5 143264094 missense unknown
R1579:Zfp316 UTSW 5 143253562 missense probably damaging 0.97
R1836:Zfp316 UTSW 5 143253423 missense probably damaging 1.00
R2058:Zfp316 UTSW 5 143263406 missense unknown
R4004:Zfp316 UTSW 5 143255119 missense possibly damaging 0.86
R4436:Zfp316 UTSW 5 143254048 missense probably damaging 1.00
R4961:Zfp316 UTSW 5 143253414 missense probably damaging 0.98
R5579:Zfp316 UTSW 5 143264491 missense unknown
R5642:Zfp316 UTSW 5 143264091 missense unknown
R5701:Zfp316 UTSW 5 143254377 missense probably benign 0.08
R5795:Zfp316 UTSW 5 143262839 missense unknown
R5861:Zfp316 UTSW 5 143263340 missense unknown
R5965:Zfp316 UTSW 5 143264672 splice site probably null
R6414:Zfp316 UTSW 5 143254884 missense possibly damaging 0.71
R6547:Zfp316 UTSW 5 143254197 missense probably damaging 1.00
R6922:Zfp316 UTSW 5 143253525 missense probably damaging 0.98
R7002:Zfp316 UTSW 5 143263355 missense unknown
R7361:Zfp316 UTSW 5 143254675 missense probably benign 0.01
R7414:Zfp316 UTSW 5 143264652 missense unknown
R7693:Zfp316 UTSW 5 143263412 missense unknown
X0022:Zfp316 UTSW 5 143255056 missense probably damaging 0.99
Z1177:Zfp316 UTSW 5 143253558 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCCGTACACGAAGCTCTTG -3'
(R):5'- TCCCAATGAGGTGGAGATGG -3'

Sequencing Primer
(F):5'- CATGCCTTGCAGGGAAAGC -3'
(R):5'- TAGCCACGGTGGAACCTGAG -3'
Posted On2015-06-10