Incidental Mutation 'R4198:Olfr573-ps1'
ID318629
Institutional Source Beutler Lab
Gene Symbol Olfr573-ps1
Ensembl Gene ENSMUSG00000052785
Gene Nameolfactory receptor 573, pseudogene 1
SynonymsMOR10-3P, MOR10-4, GA_x6K02T2PBJ9-5653743-5652872
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102941682-102942575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102941797 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 260 (F260S)
Ref Sequence ENSEMBL: ENSMUSP00000146786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064830] [ENSMUST00000210571]
Predicted Effect probably damaging
Transcript: ENSMUST00000064830
AA Change: F260S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065147
Gene: ENSMUSG00000052785
AA Change: F260S

DomainStartEndE-ValueType
Pfam:7tm_4 33 296 9.3e-109 PFAM
Pfam:7tm_1 43 288 4.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064830
AA Change: F260S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000210571
AA Change: F260S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Olfr573-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0472:Olfr573-ps1 UTSW 7 102942051 nonsense probably null
R1537:Olfr573-ps1 UTSW 7 102942340 missense probably damaging 1.00
R2168:Olfr573-ps1 UTSW 7 102942471 missense probably benign 0.00
R3781:Olfr573-ps1 UTSW 7 102942071 missense probably benign
R4200:Olfr573-ps1 UTSW 7 102941797 missense probably damaging 1.00
R4333:Olfr573-ps1 UTSW 7 102941969 missense possibly damaging 0.50
R4838:Olfr573-ps1 UTSW 7 102942246 missense probably damaging 1.00
R5041:Olfr573-ps1 UTSW 7 102942578 unclassified probably null
R5371:Olfr573-ps1 UTSW 7 102942512 missense probably benign
R5668:Olfr573-ps1 UTSW 7 102941921 missense probably benign 0.44
R7836:Olfr573-ps1 UTSW 7 102941918 missense possibly damaging 0.94
R7887:Olfr573-ps1 UTSW 7 102942151 missense possibly damaging 0.94
R7919:Olfr573-ps1 UTSW 7 102941918 missense possibly damaging 0.94
R7970:Olfr573-ps1 UTSW 7 102942151 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATGCGATTTCATTTGACTAGGC -3'
(R):5'- ACCAAGATATGATGCGCCTAG -3'

Sequencing Primer
(F):5'- GCGATTTCATTTGACTAGGCTCTGC -3'
(R):5'- CGTGTCAACAGCCTCTATGG -3'
Posted On2015-06-10