Incidental Mutation 'R4198:Trim29'
ID318636
Institutional Source Beutler Lab
Gene Symbol Trim29
Ensembl Gene ENSMUSG00000032013
Gene Nametripartite motif-containing 29
Synonyms
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location43310848-43336115 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 43311380 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 169 (E169*)
Ref Sequence ENSEMBL: ENSMUSP00000034511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034511]
Predicted Effect probably null
Transcript: ENSMUST00000034511
AA Change: E169*
SMART Domains Protein: ENSMUSP00000034511
Gene: ENSMUSG00000032013
AA Change: E169*

DomainStartEndE-ValueType
Blast:BBOX 168 216 3e-25 BLAST
BBOX 220 260 1.93e-11 SMART
low complexity region 399 410 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TRIM protein family. It has multiple zinc finger motifs and a leucine zipper motif. It has been proposed to form homo- or heterodimers which are involved in nucleic acid binding. Thus, it may act as a transcriptional regulatory factor involved in carcinogenesis and/or differentiation. It may also function in the suppression of radiosensitivity since it is associated with ataxia telangiectasia phenotype. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Trim29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02364:Trim29 APN 9 43311302 missense probably benign 0.05
IGL02387:Trim29 APN 9 43324852 missense probably benign 0.02
R1770:Trim29 UTSW 9 43332376 missense probably damaging 1.00
R1883:Trim29 UTSW 9 43311405 missense probably damaging 1.00
R1962:Trim29 UTSW 9 43311318 missense probably benign
R4200:Trim29 UTSW 9 43311380 nonsense probably null
R4303:Trim29 UTSW 9 43311122 missense probably damaging 1.00
R4863:Trim29 UTSW 9 43329575 missense possibly damaging 0.89
R4934:Trim29 UTSW 9 43310968 missense probably benign 0.36
R6171:Trim29 UTSW 9 43319377 missense probably damaging 1.00
R6737:Trim29 UTSW 9 43319384 missense probably benign 0.01
R6972:Trim29 UTSW 9 43327112 missense probably benign 0.01
R7191:Trim29 UTSW 9 43311609 missense probably damaging 1.00
R7434:Trim29 UTSW 9 43335131 missense probably damaging 1.00
R7588:Trim29 UTSW 9 43335128 missense probably damaging 1.00
R7590:Trim29 UTSW 9 43311491 missense probably damaging 1.00
X0065:Trim29 UTSW 9 43322324 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCTTCCAAGAAACCTCCTG -3'
(R):5'- GATAACAGATGCAGGTCTGGTC -3'

Sequencing Primer
(F):5'- AAGAAACCTCCTGTGACCTTTG -3'
(R):5'- CTGACAGAAGAGCTCCATAGTCTTG -3'
Posted On2015-06-10