Mutagenetix > Incidental Mutations

Incidental Mutation 'R4198:Fyco1'

318638

Institutional Source

Beutler Lab

Gene Symbol

Fyco1

Ensembl Gene

ENSMUSG00000025241

Gene Name

FYVE and coiled-coil domain containing 1

Synonyms

Mem2, ZFYVE7, 2810409M01Rik

MMRRC Submission

041640-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4198 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123789500-123851899 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123826634 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1020 (N1020D)

Ref Sequence

ENSEMBL: ENSMUSP00000133222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000184082]

Predicted Effect

probably benign
Transcript: ENSMUST00000084715
AA Change: N1020D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241
AA Change: N1020D

Domain	Start	End	E-Value	Type
Pfam:RUN	19	167	4.7e-12	PFAM
low complexity region	196	206	N/A	INTRINSIC
coiled coil region	223	270	N/A	INTRINSIC
coiled coil region	348	1110	N/A	INTRINSIC
FYVE	1124	1191	2.69e-16	SMART
PDB:1OLM\|E	1343	1428	1e-5	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000167595
AA Change: N1020D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241
AA Change: N1020D

Domain	Start	End	E-Value	Type
Pfam:RUN	20	167	7.8e-12	PFAM
low complexity region	196	206	N/A	INTRINSIC
coiled coil region	223	270	N/A	INTRINSIC
coiled coil region	348	1110	N/A	INTRINSIC
FYVE	1124	1191	2.69e-16	SMART
PDB:1OLM\|E	1343	1428	1e-5	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000184082

SMART Domains

Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241

Domain	Start	End	E-Value	Type
Pfam:RUN	7	167	4.5e-12	PFAM
low complexity region	196	206	N/A	INTRINSIC
coiled coil region	223	270	N/A	INTRINSIC
low complexity region	355	366	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain, FYVE-type zinc finger domain and Golgi dynamics (GOLD) domain. The encoded protein plays a role in microtubule plus end-directed transport of autophagic vesicles through interactions with the small GTPase Rab7, phosphatidylinositol-3-phosphate (PI3P) and the autophagosome marker LC3. Mutations in this gene are a cause of autosomal recessive congenital cataract-2 (CATC2). [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	G	A	1: 58,085,607	M1002I	probably benign	Het
Ap2b1	C	A	11: 83,342,603	Q481K	probably damaging	Het
Arhgap31	G	A	16: 38,623,913	A194V	probably damaging	Het
Atp10a	A	G	7: 58,813,686	D989G	probably damaging	Het
Ccny	G	A	18: 9,332,928	T201I	probably damaging	Het
Cdca5	T	C	19: 6,090,352	V181A	possibly damaging	Het
Ces1g	A	G	8: 93,305,868	I488T	probably benign	Het
Csmd2	A	G	4: 128,510,924	T2368A	probably benign	Het
Cux1	T	A	5: 136,286,848	I1113F	probably damaging	Het
Dnah3	C	T	7: 119,922,838	G4033D	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxg1	T	A	12: 49,385,299	S272T	possibly damaging	Het
Gprc5c	T	G	11: 114,863,860	L121R	probably damaging	Het
Hyou1	G	A	9: 44,388,859	R815H	probably damaging	Het
Kera	T	C	10: 97,612,973	*352Q	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lnpk	T	C	2: 74,569,109	E30G	probably damaging	Het
Map2	C	T	1: 66,425,298	R128C	probably damaging	Het
Olfr1357	A	T	10: 78,612,067	D191E	possibly damaging	Het
Olfr1381	G	A	11: 49,552,634	V296M	possibly damaging	Het
Olfr573-ps1	A	G	7: 102,941,797	F260S	probably damaging	Het
Olfr97	T	A	17: 37,232,134	M79L	probably benign	Het
Ror2	A	G	13: 53,110,644	M792T	probably benign	Het
Serpinb9d	A	G	13: 33,202,674		probably null	Het
Serpinb9d	A	G	13: 33,202,965	I339V	probably benign	Het
Slc1a1	A	G	19: 28,901,452	K197R	probably benign	Het
Snx20	A	G	8: 88,627,598	V168A	possibly damaging	Het
Sowaha	T	C	11: 53,478,568	E447G	possibly damaging	Het
Stard8	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	X: 99,066,508		probably benign	Het
Stx19	G	T	16: 62,822,676	C285F	possibly damaging	Het
Syp	A	G	X: 7,639,927		probably null	Het
Tbkbp1	C	T	11: 97,149,068		probably null	Het
Trim29	G	T	9: 43,311,380	E169*	probably null	Het
Ttll12	T	C	15: 83,577,013	N602D	probably damaging	Het
Zfp26	T	C	9: 20,436,716	T851A	probably benign	Het
Zfp316	T	C	5: 143,254,471	M598V	probably benign	Het
Zhx2	A	G	15: 57,821,729	I165V	probably benign	Het

Other mutations in Fyco1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00578:Fyco1	APN	9	123838897	missense	probably damaging	1.00
IGL01407:Fyco1	APN	9	123828879	missense	probably damaging	1.00
IGL01621:Fyco1	APN	9	123827182	unclassified	probably benign
IGL01908:Fyco1	APN	9	123829230	missense	probably damaging	1.00
IGL02006:Fyco1	APN	9	123829831	nonsense	probably null
IGL02899:Fyco1	APN	9	123830331	missense	possibly damaging	0.47
IGL03166:Fyco1	APN	9	123828387	missense	probably benign	0.00
IGL03272:Fyco1	APN	9	123829603	missense	probably benign	0.00
BB009:Fyco1	UTSW	9	123828990	missense	possibly damaging	0.79
BB019:Fyco1	UTSW	9	123828990	missense	possibly damaging	0.79
PIT4480001:Fyco1	UTSW	9	123828650	nonsense	probably null
R0013:Fyco1	UTSW	9	123822406	missense	probably benign
R0025:Fyco1	UTSW	9	123829009	missense	probably damaging	1.00
R0349:Fyco1	UTSW	9	123797662	missense	probably damaging	0.98
R0751:Fyco1	UTSW	9	123819153	missense	probably damaging	1.00
R1184:Fyco1	UTSW	9	123819153	missense	probably damaging	1.00
R1563:Fyco1	UTSW	9	123827182	unclassified	probably benign
R1618:Fyco1	UTSW	9	123829281	missense	probably damaging	1.00
R1732:Fyco1	UTSW	9	123819092	missense	probably benign	0.32
R1873:Fyco1	UTSW	9	123823238	missense	probably benign
R1920:Fyco1	UTSW	9	123830413	missense	probably damaging	1.00
R2108:Fyco1	UTSW	9	123797516	critical splice donor site	probably null
R2849:Fyco1	UTSW	9	123834826	nonsense	probably null
R2944:Fyco1	UTSW	9	123826648	missense	probably benign	0.02
R4035:Fyco1	UTSW	9	123801283	missense	probably benign	0.00
R4120:Fyco1	UTSW	9	123825626	missense	probably benign	0.00
R4534:Fyco1	UTSW	9	123838888	missense	probably damaging	1.00
R4535:Fyco1	UTSW	9	123838888	missense	probably damaging	1.00
R4536:Fyco1	UTSW	9	123838888	missense	probably damaging	1.00
R5408:Fyco1	UTSW	9	123829503	missense	probably damaging	0.99
R5522:Fyco1	UTSW	9	123794771	nonsense	probably null
R5755:Fyco1	UTSW	9	123828708	missense	possibly damaging	0.71
R5781:Fyco1	UTSW	9	123794833	missense	probably damaging	1.00
R5813:Fyco1	UTSW	9	123831348	missense	probably damaging	1.00
R7090:Fyco1	UTSW	9	123797719	missense	probably damaging	0.98
R7205:Fyco1	UTSW	9	123822426	missense	probably benign	0.00
R7932:Fyco1	UTSW	9	123828990	missense	possibly damaging	0.79
R8086:Fyco1	UTSW	9	123830406	missense	probably damaging	1.00
R8103:Fyco1	UTSW	9	123829388	missense	probably benign	0.17
R8504:Fyco1	UTSW	9	123830077	missense	probably benign	0.08
R8530:Fyco1	UTSW	9	123840540
Z1177:Fyco1	UTSW	9	123828323	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTTCCTCATCTAGTACAAGTGGC -3'
(R):5'- CAGTAACCACATTCCGTGCC -3'

Sequencing Primer
(F):5'- CATCTAGTACAAGTGGCTGATTTTC -3'
(R):5'- ACCCCACTATAGAGGAGGTCATG -3'

Posted On

2015-06-10