Mutagenetix > Incidental Mutations

Incidental Mutation 'R4198:Kera'

318640

Institutional Source

Beutler Lab

Gene Symbol

Kera

Ensembl Gene

ENSMUSG00000019932

Gene Name

keratocan

Synonyms

SLRR2B, CNA2

MMRRC Submission

041640-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4198 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

97606879-97613692 bp(+) (GRCm38)

Type of Mutation

makesense

DNA Base Change (assembly)

T to C at 97612973 bp

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Glutamine at position 352 (*352Q)

Ref Sequence

ENSEMBL: ENSMUSP00000100923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105286]

Predicted Effect

probably null
Transcript: ENSMUST00000105286
AA Change: *352Q

SMART Domains

Protein: ENSMUSP00000100923
Gene: ENSMUSG00000019932
AA Change: *352Q

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LRRNT	42	76	1.9e-14	SMART
LRR	71	90	2.5e-1	SMART
LRR	121	140	2.1e-1	SMART
LRR	142	161	1.5e0	SMART
LRR	166	191	3.4e-2	SMART
LRR	192	215	2.8e-2	SMART
LRR	213	232	9.2e-1	SMART
Blast:LRR	237	261	4e-8	BLAST
LRR	262	281	6.3e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a keratan sulfate proteoglycan that is involved in corneal transparency. Defects in this gene are a cause of autosomal recessive cornea plana 2 (CNA2).[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a thinner than normal corneal stroma with thicker collagen fibers which were less regularly packed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	G	A	1: 58,085,607	M1002I	probably benign	Het
Ap2b1	C	A	11: 83,342,603	Q481K	probably damaging	Het
Arhgap31	G	A	16: 38,623,913	A194V	probably damaging	Het
Atp10a	A	G	7: 58,813,686	D989G	probably damaging	Het
Ccny	G	A	18: 9,332,928	T201I	probably damaging	Het
Cdca5	T	C	19: 6,090,352	V181A	possibly damaging	Het
Ces1g	A	G	8: 93,305,868	I488T	probably benign	Het
Csmd2	A	G	4: 128,510,924	T2368A	probably benign	Het
Cux1	T	A	5: 136,286,848	I1113F	probably damaging	Het
Dnah3	C	T	7: 119,922,838	G4033D	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxg1	T	A	12: 49,385,299	S272T	possibly damaging	Het
Fyco1	T	C	9: 123,826,634	N1020D	probably benign	Het
Gprc5c	T	G	11: 114,863,860	L121R	probably damaging	Het
Hyou1	G	A	9: 44,388,859	R815H	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lnpk	T	C	2: 74,569,109	E30G	probably damaging	Het
Map2	C	T	1: 66,425,298	R128C	probably damaging	Het
Olfr1357	A	T	10: 78,612,067	D191E	possibly damaging	Het
Olfr1381	G	A	11: 49,552,634	V296M	possibly damaging	Het
Olfr573-ps1	A	G	7: 102,941,797	F260S	probably damaging	Het
Olfr97	T	A	17: 37,232,134	M79L	probably benign	Het
Ror2	A	G	13: 53,110,644	M792T	probably benign	Het
Serpinb9d	A	G	13: 33,202,674		probably null	Het
Serpinb9d	A	G	13: 33,202,965	I339V	probably benign	Het
Slc1a1	A	G	19: 28,901,452	K197R	probably benign	Het
Snx20	A	G	8: 88,627,598	V168A	possibly damaging	Het
Sowaha	T	C	11: 53,478,568	E447G	possibly damaging	Het
Stard8	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	X: 99,066,508		probably benign	Het
Stx19	G	T	16: 62,822,676	C285F	possibly damaging	Het
Syp	A	G	X: 7,639,927		probably null	Het
Tbkbp1	C	T	11: 97,149,068		probably null	Het
Trim29	G	T	9: 43,311,380	E169*	probably null	Het
Ttll12	T	C	15: 83,577,013	N602D	probably damaging	Het
Zfp26	T	C	9: 20,436,716	T851A	probably benign	Het
Zfp316	T	C	5: 143,254,471	M598V	probably benign	Het
Zhx2	A	G	15: 57,821,729	I165V	probably benign	Het

Other mutations in Kera

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01670:Kera	APN	10	97609077	missense	possibly damaging	0.79
R1309:Kera	UTSW	10	97609426	missense	possibly damaging	0.82
R1830:Kera	UTSW	10	97609147	missense	probably benign	0.29
R1895:Kera	UTSW	10	97609147	missense	probably benign	0.29
R1946:Kera	UTSW	10	97609147	missense	probably benign	0.29
R2365:Kera	UTSW	10	97608943	missense	probably benign	0.44
R3957:Kera	UTSW	10	97612845	missense	probably benign
R4624:Kera	UTSW	10	97609631	missense	probably benign	0.00
R4625:Kera	UTSW	10	97609631	missense	probably benign	0.00
R4628:Kera	UTSW	10	97609631	missense	probably benign	0.00
R4629:Kera	UTSW	10	97609631	missense	probably benign	0.00
R4640:Kera	UTSW	10	97612887	missense	probably damaging	1.00
R6496:Kera	UTSW	10	97612810	missense	probably benign
R6767:Kera	UTSW	10	97609172	missense	possibly damaging	0.92
R6999:Kera	UTSW	10	97608952	missense	probably damaging	1.00
R7017:Kera	UTSW	10	97609077	missense	possibly damaging	0.79
R7117:Kera	UTSW	10	97612852	missense	probably benign
R7519:Kera	UTSW	10	97609022	missense	probably damaging	1.00
R7968:Kera	UTSW	10	97608959	missense	possibly damaging	0.61

Predicted Primers

PCR Primer
(F):5'- TGGTCTAGATCTCCATACTCTCTGG -3'
(R):5'- AACTAATACACGTGGCCCCTG -3'

Sequencing Primer
(F):5'- TCTCTCTGCCTCCATAGATGTGAAC -3'
(R):5'- TGTGTGTCACTGACCAGAGCATC -3'

Posted On

2015-06-10