Incidental Mutation 'R4198:Olfr1381'
ID318641
Institutional Source Beutler Lab
Gene Symbol Olfr1381
Ensembl Gene ENSMUSG00000095187
Gene Nameolfactory receptor 1381
SynonymsGA_x6K02T2QP88-5884501-5883566, MOR256-26
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49543449-49556127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49552634 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 296 (V296M)
Ref Sequence ENSEMBL: ENSMUSP00000149881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167248] [ENSMUST00000213256] [ENSMUST00000215360]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167248
AA Change: V296M

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126003
Gene: ENSMUSG00000095187
AA Change: V296M

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.9e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 219 2.4e-5 PFAM
Pfam:7tm_1 41 289 1.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213256
AA Change: V296M

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000215360
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Olfr1381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Olfr1381 APN 11 49552137 missense probably damaging 1.00
IGL02166:Olfr1381 APN 11 49551930 missense probably damaging 1.00
IGL02723:Olfr1381 APN 11 49552679 missense probably benign 0.28
R0518:Olfr1381 UTSW 11 49552464 missense probably damaging 1.00
R0521:Olfr1381 UTSW 11 49552464 missense probably damaging 1.00
R2109:Olfr1381 UTSW 11 49552433 missense probably damaging 1.00
R6155:Olfr1381 UTSW 11 49552584 missense possibly damaging 0.93
R6181:Olfr1381 UTSW 11 49552293 missense probably damaging 0.97
R6250:Olfr1381 UTSW 11 49551884 missense probably damaging 1.00
R6372:Olfr1381 UTSW 11 49551930 missense probably damaging 1.00
R6616:Olfr1381 UTSW 11 49552041 missense probably damaging 0.97
R7391:Olfr1381 UTSW 11 49552544 missense probably damaging 1.00
Z1177:Olfr1381 UTSW 11 49552284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCATCTCATCTCATTGTGG -3'
(R):5'- AAGTAGTGTCTTGGCCACCTAG -3'

Sequencing Primer
(F):5'- CATCTCATTGTGGTTGCCATG -3'
(R):5'- GGTGACCCTATCTGGCACATAC -3'
Posted On2015-06-10