Incidental Mutation 'R4198:Sowaha'
ID318642
Institutional Source Beutler Lab
Gene Symbol Sowaha
Ensembl Gene ENSMUSG00000044352
Gene Namesosondowah ankyrin repeat domain family member A
SynonymsAnkrd43, A830006N08Rik
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location53476573-53480274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53478568 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 447 (E447G)
Ref Sequence ENSEMBL: ENSMUSP00000100561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067523] [ENSMUST00000104955]
Predicted Effect probably benign
Transcript: ENSMUST00000067523
Predicted Effect possibly damaging
Transcript: ENSMUST00000104955
AA Change: E447G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100561
Gene: ENSMUSG00000044352
AA Change: E447G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
low complexity region 81 100 N/A INTRINSIC
low complexity region 101 113 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 193 213 N/A INTRINSIC
low complexity region 295 308 N/A INTRINSIC
ANK 344 379 1.34e-1 SMART
ANK 383 413 5.84e-2 SMART
low complexity region 496 504 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Sowaha
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4810001:Sowaha UTSW 11 53478463 missense probably damaging 1.00
R2113:Sowaha UTSW 11 53478962 missense probably damaging 1.00
R4746:Sowaha UTSW 11 53479336 splice site probably null
R4910:Sowaha UTSW 11 53478445 missense probably damaging 1.00
R4926:Sowaha UTSW 11 53479510 missense possibly damaging 0.94
R5298:Sowaha UTSW 11 53479528 missense probably benign
R5564:Sowaha UTSW 11 53478763 missense probably damaging 1.00
R6056:Sowaha UTSW 11 53479087 missense probably damaging 1.00
R6947:Sowaha UTSW 11 53478398 missense probably benign 0.02
R7026:Sowaha UTSW 11 53479223 missense probably damaging 1.00
R7148:Sowaha UTSW 11 53479355 missense probably benign 0.04
R7263:Sowaha UTSW 11 53479658 missense probably benign 0.43
Z1176:Sowaha UTSW 11 53479025 missense probably benign 0.14
Z1177:Sowaha UTSW 11 53479360 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAGAACTTGCTGAAGGAACTTG -3'
(R):5'- AGATGGCTTTACAGCTGGTG -3'

Sequencing Primer
(F):5'- TGACTTCTTCAAGCCACGAG -3'
(R):5'- CTCTCACGGTGGCTACAC -3'
Posted On2015-06-10