Mutagenetix > Incidental Mutations

Incidental Mutation 'R4198:Ap2b1'

318643

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

041640-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4198 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 83342603 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 481 (Q481K)

Ref Sequence

ENSEMBL: ENSMUSP00000134779 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018875
AA Change: Q481K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: Q481K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065692
AA Change: Q481K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: Q481K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132178

Predicted Effect

probably damaging
Transcript: ENSMUST00000176430
AA Change: Q481K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: Q481K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176523
AA Change: Q443K

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: Q443K

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	G	A	1: 58,085,607	M1002I	probably benign	Het
Arhgap31	G	A	16: 38,623,913	A194V	probably damaging	Het
Atp10a	A	G	7: 58,813,686	D989G	probably damaging	Het
Ccny	G	A	18: 9,332,928	T201I	probably damaging	Het
Cdca5	T	C	19: 6,090,352	V181A	possibly damaging	Het
Ces1g	A	G	8: 93,305,868	I488T	probably benign	Het
Csmd2	A	G	4: 128,510,924	T2368A	probably benign	Het
Cux1	T	A	5: 136,286,848	I1113F	probably damaging	Het
Dnah3	C	T	7: 119,922,838	G4033D	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxg1	T	A	12: 49,385,299	S272T	possibly damaging	Het
Fyco1	T	C	9: 123,826,634	N1020D	probably benign	Het
Gprc5c	T	G	11: 114,863,860	L121R	probably damaging	Het
Hyou1	G	A	9: 44,388,859	R815H	probably damaging	Het
Kera	T	C	10: 97,612,973	*352Q	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lnpk	T	C	2: 74,569,109	E30G	probably damaging	Het
Map2	C	T	1: 66,425,298	R128C	probably damaging	Het
Olfr1357	A	T	10: 78,612,067	D191E	possibly damaging	Het
Olfr1381	G	A	11: 49,552,634	V296M	possibly damaging	Het
Olfr573-ps1	A	G	7: 102,941,797	F260S	probably damaging	Het
Olfr97	T	A	17: 37,232,134	M79L	probably benign	Het
Ror2	A	G	13: 53,110,644	M792T	probably benign	Het
Serpinb9d	A	G	13: 33,202,674		probably null	Het
Serpinb9d	A	G	13: 33,202,965	I339V	probably benign	Het
Slc1a1	A	G	19: 28,901,452	K197R	probably benign	Het
Snx20	A	G	8: 88,627,598	V168A	possibly damaging	Het
Sowaha	T	C	11: 53,478,568	E447G	possibly damaging	Het
Stard8	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	X: 99,066,508		probably benign	Het
Stx19	G	T	16: 62,822,676	C285F	possibly damaging	Het
Syp	A	G	X: 7,639,927		probably null	Het
Tbkbp1	C	T	11: 97,149,068		probably null	Het
Trim29	G	T	9: 43,311,380	E169*	probably null	Het
Ttll12	T	C	15: 83,577,013	N602D	probably damaging	Het
Zfp26	T	C	9: 20,436,716	T851A	probably benign	Het
Zfp316	T	C	5: 143,254,471	M598V	probably benign	Het
Zhx2	A	G	15: 57,821,729	I165V	probably benign	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3983:Ap2b1	UTSW	11	83390716	missense	probably damaging	1.00
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	intron	probably null
R5738:Ap2b1	UTSW	11	83336430	unclassified	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTTGAAAATCTGGCCCAGAAAC -3'
(R):5'- CCCCAGATGAACCTTCTTGG -3'

Sequencing Primer
(F):5'- CTTTTTATACCAAAAGAGCAACTGG -3'
(R):5'- CCTCAATGGACTATGGTTCAGGAC -3'

Posted On

2015-06-10