Incidental Mutation 'R4198:Tbkbp1'
ID318644
Institutional Source Beutler Lab
Gene Symbol Tbkbp1
Ensembl Gene ENSMUSG00000038517
Gene NameTBK1 binding protein 1
Synonyms3110043L15Rik
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4198 (G1)
Quality Score113
Status Not validated
Chromosome11
Chromosomal Location97136171-97151495 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to T at 97149068 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066078] [ENSMUST00000066078] [ENSMUST00000107613] [ENSMUST00000107614] [ENSMUST00000107614] [ENSMUST00000107615] [ENSMUST00000107615] [ENSMUST00000118375] [ENSMUST00000118375] [ENSMUST00000146374] [ENSMUST00000146374]
Predicted Effect probably null
Transcript: ENSMUST00000066078
SMART Domains Protein: ENSMUSP00000065461
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 287 342 2.8e-24 PFAM
low complexity region 343 432 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066078
SMART Domains Protein: ENSMUSP00000065461
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 287 342 2.8e-24 PFAM
low complexity region 343 432 N/A INTRINSIC
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107613
SMART Domains Protein: ENSMUSP00000103238
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 152 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107614
SMART Domains Protein: ENSMUSP00000103239
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 289 343 4.1e-21 PFAM
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107614
SMART Domains Protein: ENSMUSP00000103239
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 218 278 N/A INTRINSIC
Pfam:TBD 289 343 4.1e-21 PFAM
low complexity region 460 477 N/A INTRINSIC
low complexity region 552 562 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107615
SMART Domains Protein: ENSMUSP00000103240
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107615
SMART Domains Protein: ENSMUSP00000103240
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118375
SMART Domains Protein: ENSMUSP00000112396
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118375
SMART Domains Protein: ENSMUSP00000112396
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 156 N/A INTRINSIC
low complexity region 168 173 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
coiled coil region 217 277 N/A INTRINSIC
Pfam:TBD 286 341 4e-25 PFAM
low complexity region 342 431 N/A INTRINSIC
low complexity region 459 476 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146374
SMART Domains Protein: ENSMUSP00000114460
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146374
SMART Domains Protein: ENSMUSP00000114460
Gene: ENSMUSG00000038517

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
coiled coil region 47 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183796
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TBKBP1 is an adaptor protein that binds to TBK1 (MIM 604834) and is part of the interaction network in the TNF (MIM 191160)/NFKB (see MIM 164011) pathway (Bouwmeester et al., 2004 [PubMed 14743216]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal GM-CSF-derived bone marrow-derived dendritic cell differentiation and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Tbkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Tbkbp1 APN 11 97137648 unclassified probably benign
IGL01071:Tbkbp1 APN 11 97149562 missense probably damaging 0.99
R0017:Tbkbp1 UTSW 11 97146289 unclassified probably benign
R0445:Tbkbp1 UTSW 11 97149469 missense probably damaging 1.00
R1468:Tbkbp1 UTSW 11 97148988 missense probably damaging 1.00
R1468:Tbkbp1 UTSW 11 97148988 missense probably damaging 1.00
R4737:Tbkbp1 UTSW 11 97148648 missense probably damaging 1.00
R4816:Tbkbp1 UTSW 11 97138741 missense probably benign 0.23
R4910:Tbkbp1 UTSW 11 97139130 missense probably benign 0.23
R4947:Tbkbp1 UTSW 11 97138944 utr 3 prime probably benign
R5571:Tbkbp1 UTSW 11 97148729 missense probably damaging 1.00
R6083:Tbkbp1 UTSW 11 97147380 missense probably damaging 1.00
R6207:Tbkbp1 UTSW 11 97146339 missense probably damaging 1.00
R6595:Tbkbp1 UTSW 11 97138752 utr 3 prime probably benign
R7678:Tbkbp1 UTSW 11 97149483 missense probably damaging 1.00
R7684:Tbkbp1 UTSW 11 97147733 unclassified probably benign
R8425:Tbkbp1 UTSW 11 97138851 missense unknown
R8495:Tbkbp1 UTSW 11 97146603 missense probably benign 0.04
X0020:Tbkbp1 UTSW 11 97148974 missense probably damaging 0.99
Z1176:Tbkbp1 UTSW 11 97149528 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCGCTGAAGCTGATTTAGGG -3'
(R):5'- CTGAAGAAGTGGCTGCCTTG -3'

Sequencing Primer
(F):5'- CTGAAGCTGATTTAGGGAAGGC -3'
(R):5'- CCTTGGGGATGAGGAGCTC -3'
Posted On2015-06-10