Mutagenetix > Incidental Mutations

Incidental Mutation 'R4198:Zhx2'

318651

Institutional Source

Beutler Lab

Gene Symbol

Zhx2

Ensembl Gene

ENSMUSG00000071757

Gene Name

zinc fingers and homeoboxes 2

Synonyms

Afr1, Raf, Afr-1

MMRRC Submission

041640-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.306) question?

Stock #

R4198 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57694665-57839832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57821729 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 165 (I165V)

Ref Sequence

ENSEMBL: ENSMUSP00000094164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096430]

Predicted Effect

probably benign
Transcript: ENSMUST00000096430
AA Change: I165V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000094164
Gene: ENSMUSG00000071757
AA Change: I165V

Domain	Start	End	E-Value	Type
ZnF_C2H2	78	101	1.79e-2	SMART
ZnF_C2H2	110	133	1.99e0	SMART
low complexity region	191	209	N/A	INTRINSIC
HOX	263	324	2.11e-3	SMART
HOX	439	501	4.94e-8	SMART
HOX	530	591	2.8e-7	SMART
HOX	628	690	3.09e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160990

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 2 of this gene family. In addition to forming homodimers, this protein heterodimerizes with member 1 of the zinc fingers and homeoboxes family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Alpha-fetoprotein levels in plasma decline precipitously after birth. This gene regulates a difference in adult level and rate of neonatal decrease of AFP. The BALB/cJ substrain carries a genetic variant allele determining a slow rate of decline to adultlevel. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	G	A	1: 58,085,607	M1002I	probably benign	Het
Ap2b1	C	A	11: 83,342,603	Q481K	probably damaging	Het
Arhgap31	G	A	16: 38,623,913	A194V	probably damaging	Het
Atp10a	A	G	7: 58,813,686	D989G	probably damaging	Het
Ccny	G	A	18: 9,332,928	T201I	probably damaging	Het
Cdca5	T	C	19: 6,090,352	V181A	possibly damaging	Het
Ces1g	A	G	8: 93,305,868	I488T	probably benign	Het
Csmd2	A	G	4: 128,510,924	T2368A	probably benign	Het
Cux1	T	A	5: 136,286,848	I1113F	probably damaging	Het
Dnah3	C	T	7: 119,922,838	G4033D	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxg1	T	A	12: 49,385,299	S272T	possibly damaging	Het
Fyco1	T	C	9: 123,826,634	N1020D	probably benign	Het
Gprc5c	T	G	11: 114,863,860	L121R	probably damaging	Het
Hyou1	G	A	9: 44,388,859	R815H	probably damaging	Het
Kera	T	C	10: 97,612,973	*352Q	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lnpk	T	C	2: 74,569,109	E30G	probably damaging	Het
Map2	C	T	1: 66,425,298	R128C	probably damaging	Het
Olfr1357	A	T	10: 78,612,067	D191E	possibly damaging	Het
Olfr1381	G	A	11: 49,552,634	V296M	possibly damaging	Het
Olfr573-ps1	A	G	7: 102,941,797	F260S	probably damaging	Het
Olfr97	T	A	17: 37,232,134	M79L	probably benign	Het
Ror2	A	G	13: 53,110,644	M792T	probably benign	Het
Serpinb9d	A	G	13: 33,202,674		probably null	Het
Serpinb9d	A	G	13: 33,202,965	I339V	probably benign	Het
Slc1a1	A	G	19: 28,901,452	K197R	probably benign	Het
Snx20	A	G	8: 88,627,598	V168A	possibly damaging	Het
Sowaha	T	C	11: 53,478,568	E447G	possibly damaging	Het
Stard8	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	X: 99,066,508		probably benign	Het
Stx19	G	T	16: 62,822,676	C285F	possibly damaging	Het
Syp	A	G	X: 7,639,927		probably null	Het
Tbkbp1	C	T	11: 97,149,068		probably null	Het
Trim29	G	T	9: 43,311,380	E169*	probably null	Het
Ttll12	T	C	15: 83,577,013	N602D	probably damaging	Het
Zfp26	T	C	9: 20,436,716	T851A	probably benign	Het
Zfp316	T	C	5: 143,254,471	M598V	probably benign	Het

Other mutations in Zhx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Zhx2	APN	15	57822870	missense	probably damaging	1.00
IGL00694:Zhx2	APN	15	57821760	missense	probably benign
IGL02407:Zhx2	APN	15	57823406	missense	probably benign	0.00
IGL02456:Zhx2	APN	15	57823639	missense	possibly damaging	0.72
IGL02737:Zhx2	APN	15	57822267	missense	probably damaging	1.00
Gross	UTSW	15	57822728	missense	probably damaging	1.00
Lange	UTSW	15	57822176	missense	probably damaging	1.00
IGL03050:Zhx2	UTSW	15	57822833	missense	possibly damaging	0.90
R0010:Zhx2	UTSW	15	57821274	missense	possibly damaging	0.92
R0105:Zhx2	UTSW	15	57822695	missense	probably damaging	1.00
R0420:Zhx2	UTSW	15	57821840	missense	probably damaging	1.00
R0799:Zhx2	UTSW	15	57821313	missense	probably benign
R0800:Zhx2	UTSW	15	57822728	missense	probably damaging	1.00
R2273:Zhx2	UTSW	15	57823169	missense	probably benign	0.30
R2497:Zhx2	UTSW	15	57823155	missense	possibly damaging	0.48
R4372:Zhx2	UTSW	15	57823301	missense	probably benign	0.02
R4992:Zhx2	UTSW	15	57823587	missense	probably damaging	0.96
R4994:Zhx2	UTSW	15	57821359	missense	probably benign	0.03
R5085:Zhx2	UTSW	15	57822693	missense	probably damaging	1.00
R5141:Zhx2	UTSW	15	57821786	missense	probably benign	0.00
R5470:Zhx2	UTSW	15	57823074	missense	possibly damaging	0.76
R5659:Zhx2	UTSW	15	57822308	missense	probably benign
R5710:Zhx2	UTSW	15	57821470	nonsense	probably null
R6171:Zhx2	UTSW	15	57823206	missense	probably damaging	1.00
R7181:Zhx2	UTSW	15	57823350	missense	probably benign
R7215:Zhx2	UTSW	15	57823643	missense	probably benign
R7273:Zhx2	UTSW	15	57823428	missense	probably benign	0.09
R7575:Zhx2	UTSW	15	57823262	missense	probably damaging	1.00
R7662:Zhx2	UTSW	15	57822176	missense	probably damaging	1.00
R7883:Zhx2	UTSW	15	57821874	missense	possibly damaging	0.67
R7966:Zhx2	UTSW	15	57821667	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTTCACAGAACACGTGGACATG -3'
(R):5'- GATCTCAGCTGTGTCTGTCAC -3'

Sequencing Primer
(F):5'- GTGGACATGCAACATCCTAACGTG -3'
(R):5'- AGCTGTGTCTGTCACCAGGC -3'

Posted On

2015-06-10