Incidental Mutation 'R4198:Zhx2'
ID318651
Institutional Source Beutler Lab
Gene Symbol Zhx2
Ensembl Gene ENSMUSG00000071757
Gene Namezinc fingers and homeoboxes 2
SynonymsAfr1, Raf, Afr-1
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location57694665-57839832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57821729 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 165 (I165V)
Ref Sequence ENSEMBL: ENSMUSP00000094164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096430]
Predicted Effect probably benign
Transcript: ENSMUST00000096430
AA Change: I165V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094164
Gene: ENSMUSG00000071757
AA Change: I165V

DomainStartEndE-ValueType
ZnF_C2H2 78 101 1.79e-2 SMART
ZnF_C2H2 110 133 1.99e0 SMART
low complexity region 191 209 N/A INTRINSIC
HOX 263 324 2.11e-3 SMART
HOX 439 501 4.94e-8 SMART
HOX 530 591 2.8e-7 SMART
HOX 628 690 3.09e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160990
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 2 of this gene family. In addition to forming homodimers, this protein heterodimerizes with member 1 of the zinc fingers and homeoboxes family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Alpha-fetoprotein levels in plasma decline precipitously after birth. This gene regulates a difference in adult level and rate of neonatal decrease of AFP. The BALB/cJ substrain carries a genetic variant allele determining a slow rate of decline to adultlevel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Other mutations in Zhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Zhx2 APN 15 57822870 missense probably damaging 1.00
IGL00694:Zhx2 APN 15 57821760 missense probably benign
IGL02407:Zhx2 APN 15 57823406 missense probably benign 0.00
IGL02456:Zhx2 APN 15 57823639 missense possibly damaging 0.72
IGL02737:Zhx2 APN 15 57822267 missense probably damaging 1.00
IGL03050:Zhx2 UTSW 15 57822833 missense possibly damaging 0.90
R0010:Zhx2 UTSW 15 57821274 missense possibly damaging 0.92
R0105:Zhx2 UTSW 15 57822695 missense probably damaging 1.00
R0420:Zhx2 UTSW 15 57821840 missense probably damaging 1.00
R0799:Zhx2 UTSW 15 57821313 missense probably benign
R0800:Zhx2 UTSW 15 57822728 missense probably damaging 1.00
R2273:Zhx2 UTSW 15 57823169 missense probably benign 0.30
R2497:Zhx2 UTSW 15 57823155 missense possibly damaging 0.48
R4372:Zhx2 UTSW 15 57823301 missense probably benign 0.02
R4992:Zhx2 UTSW 15 57823587 missense probably damaging 0.96
R4994:Zhx2 UTSW 15 57821359 missense probably benign 0.03
R5085:Zhx2 UTSW 15 57822693 missense probably damaging 1.00
R5141:Zhx2 UTSW 15 57821786 missense probably benign 0.00
R5470:Zhx2 UTSW 15 57823074 missense possibly damaging 0.76
R5659:Zhx2 UTSW 15 57822308 missense probably benign
R5710:Zhx2 UTSW 15 57821470 nonsense probably null
R6171:Zhx2 UTSW 15 57823206 missense probably damaging 1.00
R7181:Zhx2 UTSW 15 57823350 missense probably benign
R7215:Zhx2 UTSW 15 57823643 missense probably benign
R7273:Zhx2 UTSW 15 57823428 missense probably benign 0.09
R7575:Zhx2 UTSW 15 57823262 missense probably damaging 1.00
R7662:Zhx2 UTSW 15 57822176 missense probably damaging 1.00
R7883:Zhx2 UTSW 15 57821874 missense possibly damaging 0.67
R7966:Zhx2 UTSW 15 57821874 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTTCACAGAACACGTGGACATG -3'
(R):5'- GATCTCAGCTGTGTCTGTCAC -3'

Sequencing Primer
(F):5'- GTGGACATGCAACATCCTAACGTG -3'
(R):5'- AGCTGTGTCTGTCACCAGGC -3'
Posted On2015-06-10