Incidental Mutation 'R4198:Stx19'
ID318654
Institutional Source Beutler Lab
Gene Symbol Stx19
Ensembl Gene ENSMUSG00000047854
Gene Namesyntaxin 19
SynonymsA030009B12Rik
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location62814676-62824346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62822676 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 285 (C285F)
Ref Sequence ENSEMBL: ENSMUSP00000055901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055557] [ENSMUST00000089289] [ENSMUST00000232561]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055557
AA Change: C285F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000055901
Gene: ENSMUSG00000047854
AA Change: C285F

DomainStartEndE-ValueType
Blast:SynN 51 161 4e-18 BLAST
t_SNARE 202 269 3.21e-9 SMART
low complexity region 277 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089289
SMART Domains Protein: ENSMUSP00000086703
Gene: ENSMUSG00000022911

DomainStartEndE-ValueType
Pfam:Arf 8 190 8.2e-43 PFAM
Pfam:SRPRB 19 157 7.1e-8 PFAM
Pfam:Roc 23 134 5.4e-9 PFAM
Pfam:Ras 23 183 3.1e-10 PFAM
low complexity region 207 233 N/A INTRINSIC
low complexity region 265 281 N/A INTRINSIC
low complexity region 322 334 N/A INTRINSIC
low complexity region 344 349 N/A INTRINSIC
low complexity region 366 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132902
Predicted Effect probably benign
Transcript: ENSMUST00000232561
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Stx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00709:Stx19 APN 16 62822580 missense probably benign 0.08
PIT4520001:Stx19 UTSW 16 62822508 missense probably benign 0.09
R0696:Stx19 UTSW 16 62822043 missense probably benign 0.22
R1429:Stx19 UTSW 16 62822597 missense possibly damaging 0.75
R1762:Stx19 UTSW 16 62821980 missense probably damaging 1.00
R4720:Stx19 UTSW 16 62822319 missense probably damaging 1.00
R4726:Stx19 UTSW 16 62822132 missense probably benign 0.23
R4745:Stx19 UTSW 16 62822420 missense probably benign 0.00
R5224:Stx19 UTSW 16 62822574 missense probably benign 0.05
R5297:Stx19 UTSW 16 62821974 missense probably damaging 1.00
R6416:Stx19 UTSW 16 62822057 missense probably damaging 1.00
R7768:Stx19 UTSW 16 62822204 missense probably benign 0.36
R7783:Stx19 UTSW 16 62822286 missense probably benign
R8096:Stx19 UTSW 16 62822161 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AACCAAGTGAAGGACCTCCG -3'
(R):5'- CTTGTGTCACTGGCTTCAGC -3'

Sequencing Primer
(F):5'- CGGGACCTTTTCATTCAGATATC -3'
(R):5'- CACTGGCTTCAGCAGTTTCTGTAATG -3'
Posted On2015-06-10