Mutagenetix > Incidental Mutations

Incidental Mutation 'R4198:Olfr97'

318655

Institutional Source

Beutler Lab

Gene Symbol

Olfr97

Ensembl Gene

ENSMUSG00000058802

Gene Name

olfactory receptor 97

Synonyms

MOR156-2, GA_x6K02T2PSCP-1672287-1671355

MMRRC Submission

041640-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R4198 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

37230963-37237330 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 37232134 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 79 (M79L)

Ref Sequence

ENSEMBL: ENSMUSP00000151044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073667] [ENSMUST00000207414] [ENSMUST00000213328] [ENSMUST00000214622] [ENSMUST00000214848] [ENSMUST00000216225]

Predicted Effect

probably benign
Transcript: ENSMUST00000073667
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000094937
Gene: ENSMUSG00000058802
AA Change: M79L

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srv	24	305	4.5e-9	PFAM
Pfam:7tm_4	29	306	1.4e-54	PFAM
Pfam:7TM_GPCR_Srsx	33	303	1.1e-5	PFAM
Pfam:7tm_1	39	288	8.6e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000207414
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000213328
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000214622
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000214848
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

probably benign
Transcript: ENSMUST00000216225
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	G	A	1: 58,085,607	M1002I	probably benign	Het
Ap2b1	C	A	11: 83,342,603	Q481K	probably damaging	Het
Arhgap31	G	A	16: 38,623,913	A194V	probably damaging	Het
Atp10a	A	G	7: 58,813,686	D989G	probably damaging	Het
Ccny	G	A	18: 9,332,928	T201I	probably damaging	Het
Cdca5	T	C	19: 6,090,352	V181A	possibly damaging	Het
Ces1g	A	G	8: 93,305,868	I488T	probably benign	Het
Csmd2	A	G	4: 128,510,924	T2368A	probably benign	Het
Cux1	T	A	5: 136,286,848	I1113F	probably damaging	Het
Dnah3	C	T	7: 119,922,838	G4033D	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxg1	T	A	12: 49,385,299	S272T	possibly damaging	Het
Fyco1	T	C	9: 123,826,634	N1020D	probably benign	Het
Gprc5c	T	G	11: 114,863,860	L121R	probably damaging	Het
Hyou1	G	A	9: 44,388,859	R815H	probably damaging	Het
Kera	T	C	10: 97,612,973	*352Q	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lnpk	T	C	2: 74,569,109	E30G	probably damaging	Het
Map2	C	T	1: 66,425,298	R128C	probably damaging	Het
Olfr1357	A	T	10: 78,612,067	D191E	possibly damaging	Het
Olfr1381	G	A	11: 49,552,634	V296M	possibly damaging	Het
Olfr573-ps1	A	G	7: 102,941,797	F260S	probably damaging	Het
Ror2	A	G	13: 53,110,644	M792T	probably benign	Het
Serpinb9d	A	G	13: 33,202,674		probably null	Het
Serpinb9d	A	G	13: 33,202,965	I339V	probably benign	Het
Slc1a1	A	G	19: 28,901,452	K197R	probably benign	Het
Snx20	A	G	8: 88,627,598	V168A	possibly damaging	Het
Sowaha	T	C	11: 53,478,568	E447G	possibly damaging	Het
Stard8	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	X: 99,066,508		probably benign	Het
Stx19	G	T	16: 62,822,676	C285F	possibly damaging	Het
Syp	A	G	X: 7,639,927		probably null	Het
Tbkbp1	C	T	11: 97,149,068		probably null	Het
Trim29	G	T	9: 43,311,380	E169*	probably null	Het
Ttll12	T	C	15: 83,577,013	N602D	probably damaging	Het
Zfp26	T	C	9: 20,436,716	T851A	probably benign	Het
Zfp316	T	C	5: 143,254,471	M598V	probably benign	Het
Zhx2	A	G	15: 57,821,729	I165V	probably benign	Het

Other mutations in Olfr97

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01934:Olfr97	APN	17	37231548	missense	probably damaging	1.00
IGL02424:Olfr97	APN	17	37232372	start gained	probably benign
IGL03129:Olfr97	APN	17	37232196	missense	probably damaging	1.00
R0619:Olfr97	UTSW	17	37232155	missense	possibly damaging	0.92
R0811:Olfr97	UTSW	17	37232332	missense	probably benign	0.00
R0812:Olfr97	UTSW	17	37232332	missense	probably benign	0.00
R1122:Olfr97	UTSW	17	37232043	missense	probably damaging	1.00
R1927:Olfr97	UTSW	17	37231543	missense	probably damaging	1.00
R1997:Olfr97	UTSW	17	37231632	missense	probably damaging	1.00
R3771:Olfr97	UTSW	17	37231465	missense	possibly damaging	0.53
R3775:Olfr97	UTSW	17	37232230	missense	probably damaging	0.98
R4182:Olfr97	UTSW	17	37231848	missense	possibly damaging	0.93
R4183:Olfr97	UTSW	17	37231848	missense	possibly damaging	0.93
R4184:Olfr97	UTSW	17	37231848	missense	possibly damaging	0.93
R7453:Olfr97	UTSW	17	37231980	missense	probably damaging	1.00
R7615:Olfr97	UTSW	17	37231450	missense	probably benign	0.25
R7829:Olfr97	UTSW	17	37232310	missense	probably benign	0.01
R8223:Olfr97	UTSW	17	37231836	missense	possibly damaging	0.89
R8526:Olfr97	UTSW	17	37231579	missense	probably damaging	0.97
Z1177:Olfr97	UTSW	17	37232296	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCATTAGAAGTGGGTACAGCAG -3'
(R):5'- GATGAACTGCAGTCAGGCTC -3'

Sequencing Primer
(F):5'- GTACAGCAGTGGGTGGC -3'
(R):5'- TGGGACTGTCCAGTAACTCAG -3'

Posted On

2015-06-10