Incidental Mutation 'R4198:Olfr97'
ID318655
Institutional Source Beutler Lab
Gene Symbol Olfr97
Ensembl Gene ENSMUSG00000058802
Gene Nameolfactory receptor 97
SynonymsMOR156-2, GA_x6K02T2PSCP-1672287-1671355
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37230963-37237330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37232134 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 79 (M79L)
Ref Sequence ENSEMBL: ENSMUSP00000151044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073667] [ENSMUST00000207414] [ENSMUST00000213328] [ENSMUST00000214622] [ENSMUST00000214848] [ENSMUST00000216225]
Predicted Effect probably benign
Transcript: ENSMUST00000073667
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000094937
Gene: ENSMUSG00000058802
AA Change: M79L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 24 305 4.5e-9 PFAM
Pfam:7tm_4 29 306 1.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.1e-5 PFAM
Pfam:7tm_1 39 288 8.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207414
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000213328
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000214622
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000214848
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216225
AA Change: M79L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Olfr97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Olfr97 APN 17 37231548 missense probably damaging 1.00
IGL02424:Olfr97 APN 17 37232372 start gained probably benign
IGL03129:Olfr97 APN 17 37232196 missense probably damaging 1.00
R0619:Olfr97 UTSW 17 37232155 missense possibly damaging 0.92
R0811:Olfr97 UTSW 17 37232332 missense probably benign 0.00
R0812:Olfr97 UTSW 17 37232332 missense probably benign 0.00
R1122:Olfr97 UTSW 17 37232043 missense probably damaging 1.00
R1927:Olfr97 UTSW 17 37231543 missense probably damaging 1.00
R1997:Olfr97 UTSW 17 37231632 missense probably damaging 1.00
R3771:Olfr97 UTSW 17 37231465 missense possibly damaging 0.53
R3775:Olfr97 UTSW 17 37232230 missense probably damaging 0.98
R4182:Olfr97 UTSW 17 37231848 missense possibly damaging 0.93
R4183:Olfr97 UTSW 17 37231848 missense possibly damaging 0.93
R4184:Olfr97 UTSW 17 37231848 missense possibly damaging 0.93
R7453:Olfr97 UTSW 17 37231980 missense probably damaging 1.00
R7615:Olfr97 UTSW 17 37231450 missense probably benign 0.25
R7829:Olfr97 UTSW 17 37232310 missense probably benign 0.01
R8223:Olfr97 UTSW 17 37231836 missense possibly damaging 0.89
R8526:Olfr97 UTSW 17 37231579 missense probably damaging 0.97
Z1177:Olfr97 UTSW 17 37232296 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATTAGAAGTGGGTACAGCAG -3'
(R):5'- GATGAACTGCAGTCAGGCTC -3'

Sequencing Primer
(F):5'- GTACAGCAGTGGGTGGC -3'
(R):5'- TGGGACTGTCCAGTAACTCAG -3'
Posted On2015-06-10