Incidental Mutation 'R4198:Ccny'
ID318656
Institutional Source Beutler Lab
Gene Symbol Ccny
Ensembl Gene ENSMUSG00000024286
Gene Namecyclin Y
Synonyms5730405I09Rik, 4631402G10Rik, 1700025H17Rik, 3110050L10Rik
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location9314044-9450150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9332928 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 201 (T201I)
Ref Sequence ENSEMBL: ENSMUSP00000050001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053917]
Predicted Effect probably damaging
Transcript: ENSMUST00000053917
AA Change: T201I

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000050001
Gene: ENSMUSG00000024286
AA Change: T201I

DomainStartEndE-ValueType
CYCLIN 173 258 1.36e-7 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclins, such as CCNY, control cell division cycles and regulate cyclin-dependent kinases (e.g., CDC2; MIM 116940) (Li et al., 2009 [PubMed 18060517]).[supplied by OMIM, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adipogenesis and lipid production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Ccny
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ccny APN 18 9345444 missense probably benign 0.18
IGL01986:Ccny APN 18 9377817 missense probably damaging 1.00
IGL03000:Ccny APN 18 9353489 missense probably benign 0.12
IGL03257:Ccny APN 18 9386747 missense possibly damaging 0.84
R0015:Ccny UTSW 18 9316682 splice site probably benign
R0015:Ccny UTSW 18 9316682 splice site probably benign
R0372:Ccny UTSW 18 9345201 missense probably damaging 1.00
R0440:Ccny UTSW 18 9332917 missense probably benign 0.21
R1645:Ccny UTSW 18 9345199 missense probably damaging 0.99
R2044:Ccny UTSW 18 9449644 missense probably damaging 1.00
R2405:Ccny UTSW 18 9353480 missense probably benign 0.08
R3847:Ccny UTSW 18 9449641 missense probably benign 0.37
R3864:Ccny UTSW 18 9449604 missense probably damaging 1.00
R4964:Ccny UTSW 18 9449516 critical splice donor site probably null
R6474:Ccny UTSW 18 9345427 missense probably damaging 1.00
R7858:Ccny UTSW 18 9386782 missense probably damaging 0.99
X0050:Ccny UTSW 18 9332874 missense possibly damaging 0.87
Z1177:Ccny UTSW 18 9353494 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACCACCCCAAATAGGCATGG -3'
(R):5'- GTCAGTACCTTTGCCATTGC -3'

Sequencing Primer
(F):5'- ATGGTATCCCCGGAACTTACATG -3'
(R):5'- ACCTTTGCCATTGCTCTTATAAATG -3'
Posted On2015-06-10