Mutagenetix > Incidental Mutations

Incidental Mutation 'R4198:Slc1a1'

318659

Institutional Source

Beutler Lab

Gene Symbol

Slc1a1

Ensembl Gene

ENSMUSG00000024935

Gene Name

solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1

Synonyms

D130048G10Rik, MEAAC1, EAAC1, EAAT3

MMRRC Submission

041640-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4198 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28835049-28913960 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28901452 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 197 (K197R)

Ref Sequence

ENSEMBL: ENSMUSP00000025875 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025875] [ENSMUST00000175647] [ENSMUST00000179171]

Predicted Effect

probably benign
Transcript: ENSMUST00000025875
AA Change: K197R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000025875
Gene: ENSMUSG00000024935
AA Change: K197R

Domain	Start	End	E-Value	Type
Pfam:SDF	20	464	2.3e-135	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160702

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161119

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162189

Predicted Effect

probably benign
Transcript: ENSMUST00000175647

SMART Domains

Protein: ENSMUSP00000135813
Gene: ENSMUSG00000064202

Domain	Start	End	E-Value	Type
Pfam:SPATA6	6	78	4.5e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179171

SMART Domains

Protein: ENSMUSP00000137486
Gene: ENSMUSG00000064202

Domain	Start	End	E-Value	Type
transmembrane domain	36	58	N/A	INTRINSIC

Meta Mutation Damage Score

0.0597

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the high-affinity glutamate transporters that play an essential role in transporting glutamate across plasma membranes. In brain, these transporters are crucial in terminating the postsynaptic action of the neurotransmitter glutamate, and in maintaining extracellular glutamate concentrations below neurotoxic levels. This transporter also transports aspartate, and mutations in this gene are thought to cause dicarboxylicamino aciduria, also known as glutamate-aspartate transport defect. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced locomotor activity and excessive excretion of glutamate and aspartate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aox1	G	A	1: 58,085,607	M1002I	probably benign	Het
Ap2b1	C	A	11: 83,342,603	Q481K	probably damaging	Het
Arhgap31	G	A	16: 38,623,913	A194V	probably damaging	Het
Atp10a	A	G	7: 58,813,686	D989G	probably damaging	Het
Ccny	G	A	18: 9,332,928	T201I	probably damaging	Het
Cdca5	T	C	19: 6,090,352	V181A	possibly damaging	Het
Ces1g	A	G	8: 93,305,868	I488T	probably benign	Het
Csmd2	A	G	4: 128,510,924	T2368A	probably benign	Het
Cux1	T	A	5: 136,286,848	I1113F	probably damaging	Het
Dnah3	C	T	7: 119,922,838	G4033D	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Foxg1	T	A	12: 49,385,299	S272T	possibly damaging	Het
Fyco1	T	C	9: 123,826,634	N1020D	probably benign	Het
Gprc5c	T	G	11: 114,863,860	L121R	probably damaging	Het
Hyou1	G	A	9: 44,388,859	R815H	probably damaging	Het
Kera	T	C	10: 97,612,973	*352Q	probably null	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lnpk	T	C	2: 74,569,109	E30G	probably damaging	Het
Map2	C	T	1: 66,425,298	R128C	probably damaging	Het
Olfr1357	A	T	10: 78,612,067	D191E	possibly damaging	Het
Olfr1381	G	A	11: 49,552,634	V296M	possibly damaging	Het
Olfr573-ps1	A	G	7: 102,941,797	F260S	probably damaging	Het
Olfr97	T	A	17: 37,232,134	M79L	probably benign	Het
Ror2	A	G	13: 53,110,644	M792T	probably benign	Het
Serpinb9d	A	G	13: 33,202,674		probably null	Het
Serpinb9d	A	G	13: 33,202,965	I339V	probably benign	Het
Snx20	A	G	8: 88,627,598	V168A	possibly damaging	Het
Sowaha	T	C	11: 53,478,568	E447G	possibly damaging	Het
Stard8	AGAGGAGGAGGAGGAGGAGGA	AGAGGAGGAGGAGGAGGA	X: 99,066,508		probably benign	Het
Stx19	G	T	16: 62,822,676	C285F	possibly damaging	Het
Syp	A	G	X: 7,639,927		probably null	Het
Tbkbp1	C	T	11: 97,149,068		probably null	Het
Trim29	G	T	9: 43,311,380	E169*	probably null	Het
Ttll12	T	C	15: 83,577,013	N602D	probably damaging	Het
Zfp26	T	C	9: 20,436,716	T851A	probably benign	Het
Zfp316	T	C	5: 143,254,471	M598V	probably benign	Het
Zhx2	A	G	15: 57,821,729	I165V	probably benign	Het

Other mutations in Slc1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02170:Slc1a1	APN	19	28902753	missense	possibly damaging	0.66
IGL02726:Slc1a1	APN	19	28911769	missense	probably benign	0.04
IGL02865:Slc1a1	APN	19	28905338	missense	probably damaging	1.00
R0008:Slc1a1	UTSW	19	28901484	missense	probably benign	0.01
R0008:Slc1a1	UTSW	19	28901484	missense	probably benign	0.01
R0490:Slc1a1	UTSW	19	28897531	missense	probably benign
R1219:Slc1a1	UTSW	19	28904746	splice site	probably benign
R1333:Slc1a1	UTSW	19	28835211	start gained	probably benign
R1623:Slc1a1	UTSW	19	28904722	missense	probably benign	0.09
R1669:Slc1a1	UTSW	19	28911794	missense	probably benign	0.04
R1746:Slc1a1	UTSW	19	28894469	missense	probably benign	0.31
R2516:Slc1a1	UTSW	19	28892912	missense	probably benign	0.31
R4199:Slc1a1	UTSW	19	28901452	missense	probably benign	0.00
R4200:Slc1a1	UTSW	19	28901452	missense	probably benign	0.00
R4432:Slc1a1	UTSW	19	28902709	missense	probably benign	0.21
R4744:Slc1a1	UTSW	19	28894525	missense	probably benign
R5110:Slc1a1	UTSW	19	28911808	missense	probably benign	0.14
R5341:Slc1a1	UTSW	19	28897568	missense	probably benign
R6136:Slc1a1	UTSW	19	28905410	missense	probably damaging	1.00
R6153:Slc1a1	UTSW	19	28909535	missense	probably damaging	0.98
R6640:Slc1a1	UTSW	19	28894570	critical splice donor site	probably null
R7950:Slc1a1	UTSW	19	28911761	missense	probably benign	0.00
R8182:Slc1a1	UTSW	19	28901448	missense	probably benign	0.07
RF020:Slc1a1	UTSW	19	28879155	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACATGTTCATGGAGGAGCTTG -3'
(R):5'- TCTTCCCAGGTCTGAGAAGG -3'

Sequencing Primer
(F):5'- GCTTGTTAAGGAGACAAAGCCCC -3'
(R):5'- TCCCAGGTCTGAGAAGGCATTATC -3'

Posted On

2015-06-10