Incidental Mutation 'R4198:Syp'
ID318661
Institutional Source Beutler Lab
Gene Symbol Syp
Ensembl Gene ENSMUSG00000031144
Gene Namesynaptophysin
Synonymsp38, Syp I, Syn, A230093K24Rik
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R4198 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location7638471-7653256 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 7639927 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000069520] [ENSMUST00000069520] [ENSMUST00000115725] [ENSMUST00000115726] [ENSMUST00000155090]
Predicted Effect probably null
Transcript: ENSMUST00000069520
SMART Domains Protein: ENSMUSP00000069429
Gene: ENSMUSG00000031144

DomainStartEndE-ValueType
Pfam:MARVEL 21 222 5.7e-47 PFAM
low complexity region 244 307 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000069520
SMART Domains Protein: ENSMUSP00000069429
Gene: ENSMUSG00000031144

DomainStartEndE-ValueType
Pfam:MARVEL 21 222 5.7e-47 PFAM
low complexity region 244 307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115725
SMART Domains Protein: ENSMUSP00000111390
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
Pfam:Ion_trans 129 371 9.3e-59 PFAM
PDB:4DEY|B 372 415 2e-21 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 3.8e-44 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 909 1139 1.1e-50 PFAM
Pfam:Ion_trans 1227 1436 2.7e-64 PFAM
Pfam:PKD_channel 1272 1443 1e-10 PFAM
Blast:EFh 1457 1485 2e-8 BLAST
Ca_chan_IQ 1571 1605 3.71e-14 SMART
low complexity region 1636 1655 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115726
SMART Domains Protein: ENSMUSP00000111391
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
Pfam:Ion_trans 91 383 2.1e-70 PFAM
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
Pfam:Ion_trans 528 768 3.8e-54 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 873 1151 2.4e-59 PFAM
Pfam:Ion_trans 1192 1455 2.6e-67 PFAM
Pfam:PKD_channel 1285 1450 8.5e-10 PFAM
Pfam:GPHH 1457 1526 2.7e-37 PFAM
Ca_chan_IQ 1578 1612 3.71e-14 SMART
Pfam:CAC1F_C 1622 1983 1.5e-164 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128890
SMART Domains Protein: ENSMUSP00000118544
Gene: ENSMUSG00000031144

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:MARVEL 46 165 2.3e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128890
SMART Domains Protein: ENSMUSP00000118544
Gene: ENSMUSG00000031144

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:MARVEL 46 165 2.3e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128890
SMART Domains Protein: ENSMUSP00000118544
Gene: ENSMUSG00000031144

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:MARVEL 46 165 2.3e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128890
SMART Domains Protein: ENSMUSP00000118544
Gene: ENSMUSG00000031144

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:MARVEL 46 165 2.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150572
Predicted Effect probably benign
Transcript: ENSMUST00000155090
SMART Domains Protein: ENSMUSP00000138116
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 1.1e-59 PFAM
PDB:4DEY|B 372 415 4e-22 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of small synaptic vesicles in brain and endocrine cells. The protein also binds cholesterol and is thought to direct targeting of vesicle-associated membrane protein 2 (synaptobrevin) to intracellular compartments. Mutations in this gene are associated with X-linked mental retardation (XLMR). [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for either one of two independently generated knock-out mutations are viable and fertile and display normal central nervous system morphology and synaptic transmission with no detectable changes in synaptic plasticity or neurotransmitter release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Syp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1466:Syp UTSW X 7648705 unclassified probably benign
R1466:Syp UTSW X 7648705 unclassified probably benign
R4199:Syp UTSW X 7639927 splice site probably null
R4276:Syp UTSW X 7638692 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCACATGTCCTATCCCCAGG -3'
(R):5'- TCACTTCACAACAGGGGTAC -3'

Sequencing Primer
(F):5'- CCAGGGATCATTGCTTGGCAG -3'
(R):5'- CACGGCCTTATGTGACGTCATAG -3'
Posted On2015-06-10