Incidental Mutation 'R4198:Stard8'
ID318663
Institutional Source Beutler Lab
Gene Symbol Stard8
Ensembl Gene ENSMUSG00000031216
Gene NameSTART domain containing 8
Synonyms
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4198 (G1)
Quality Score103
Status Not validated
ChromosomeX
Chromosomal Location99003248-99074728 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) AGAGGAGGAGGAGGAGGAGGA to AGAGGAGGAGGAGGAGGA at 99066508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036606] [ENSMUST00000149999]
Predicted Effect probably benign
Transcript: ENSMUST00000036606
SMART Domains Protein: ENSMUSP00000044491
Gene: ENSMUSG00000031216

DomainStartEndE-ValueType
low complexity region 44 65 N/A INTRINSIC
low complexity region 72 90 N/A INTRINSIC
low complexity region 288 299 N/A INTRINSIC
coiled coil region 334 372 N/A INTRINSIC
low complexity region 396 417 N/A INTRINSIC
low complexity region 457 464 N/A INTRINSIC
RhoGAP 579 770 1.97e-56 SMART
START 814 1016 2.13e-69 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145820
Predicted Effect probably benign
Transcript: ENSMUST00000149999
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of Rho GTPase activating proteins that contain a steroidogenic acute regulatory protein related lipid transfer domain. The encoded protein localizes to focal adhesions and may be involved in regulating cell morphology. This protein may also function as a tumor suppressor. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Stard8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Stard8 APN X 99069335 missense probably damaging 1.00
IGL01063:Stard8 APN X 99073088 missense probably damaging 1.00
FR4304:Stard8 UTSW X 99066505 unclassified probably benign
FR4976:Stard8 UTSW X 99066513 unclassified probably benign
FR4976:Stard8 UTSW X 99066525 unclassified probably benign
R4641:Stard8 UTSW X 99066508 unclassified probably benign
R8246:Stard8 UTSW X 99065964 missense probably benign
R8247:Stard8 UTSW X 99065964 missense probably benign
RF002:Stard8 UTSW X 99066515 nonsense probably null
RF010:Stard8 UTSW X 99066517 unclassified probably benign
RF043:Stard8 UTSW X 99066520 unclassified probably benign
RF043:Stard8 UTSW X 99066527 unclassified probably benign
RF051:Stard8 UTSW X 99066524 unclassified probably benign
RF055:Stard8 UTSW X 99066520 unclassified probably benign
RF063:Stard8 UTSW X 99066524 nonsense probably null
RF064:Stard8 UTSW X 99066527 nonsense probably null
X0004:Stard8 UTSW X 99066683 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TACCCAGCTGAGCCTATACAG -3'
(R):5'- CTGCAGTCGAGTTAGCTTCTTG -3'

Sequencing Primer
(F):5'- CCTATACAGGCTGAAGCTGAGGC -3'
(R):5'- AGCCTGTACCAATGGTTCGAC -3'
Posted On2015-06-10