Incidental Mutation 'R4199:Lcn9'
ID318664
Institutional Source Beutler Lab
Gene Symbol Lcn9
Ensembl Gene ENSMUSG00000023210
Gene Namelipocalin 9
Synonyms
MMRRC Submission 041029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4199 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25823153-25825537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25824761 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 171 (T171A)
Ref Sequence ENSEMBL: ENSMUSP00000023978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023978]
Predicted Effect probably benign
Transcript: ENSMUST00000023978
AA Change: T171A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023978
Gene: ENSMUSG00000023210
AA Change: T171A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Lipocalin 34 174 6e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the lipocalin family, such as LCN9, have a common structure consisting of an 8-stranded antiparallel beta-barrel that forms a cup-shaped ligand-binding pocket or calyx. Lipocalins generally bind small hydrophobic ligands and transport them to specific cells (Suzuki et al., 2004 [PubMed 15363845]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,661,048 probably benign Het
Cbarp G T 10: 80,135,492 H173Q probably damaging Het
Ccna1 G A 3: 55,047,315 A177V possibly damaging Het
Ces1f A G 8: 93,256,889 F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Disc1 C T 8: 125,148,459 T556I probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Dnmt1 A G 9: 20,938,118 S63P probably benign Het
Eml2 G A 7: 19,179,439 A121T probably benign Het
Eps8 T C 6: 137,514,327 N351S probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo34 T A 14: 47,530,997 W605R probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gal3st3 T A 19: 5,307,780 Y394* probably null Het
Gga1 A G 15: 78,889,075 E301G probably damaging Het
Ifitm5 T A 7: 140,949,236 *153Y probably null Het
Ighg2b G T 12: 113,307,287 P110Q probably damaging Het
Il17rb C T 14: 29,996,644 D494N probably benign Het
Irf2bp2 C A 8: 126,591,574 A418S probably damaging Het
Lcorl T C 5: 45,733,788 K408E possibly damaging Het
Myh14 T A 7: 44,615,503 R1653* probably null Het
Naa16 A T 14: 79,355,871 H420Q probably damaging Het
Nol8 T A 13: 49,661,748 V426E possibly damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Papln C T 12: 83,783,392 T1012I probably null Het
Pkd1 A G 17: 24,570,030 T921A probably benign Het
Pknox1 C A 17: 31,602,816 Q294K probably damaging Het
Ppp2ca A G 11: 52,099,101 N18S probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Sfxn5 T A 6: 85,215,742 E319V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Spef2 A G 15: 9,667,280 F774S probably damaging Het
Syp A G X: 7,639,927 probably null Het
Zfp276 A G 8: 123,267,825 T544A probably damaging Het
Other mutations in Lcn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01952:Lcn9 APN 2 25824538 missense probably damaging 1.00
IGL02417:Lcn9 APN 2 25823680 missense possibly damaging 0.91
PIT4418001:Lcn9 UTSW 2 25824541 missense probably damaging 1.00
R1479:Lcn9 UTSW 2 25823703 splice site probably benign
R1657:Lcn9 UTSW 2 25824710 missense probably benign 0.17
R4526:Lcn9 UTSW 2 25824508 missense possibly damaging 0.85
R4570:Lcn9 UTSW 2 25823579 missense probably benign 0.04
R5232:Lcn9 UTSW 2 25824055 critical splice donor site probably null
R5577:Lcn9 UTSW 2 25823651 missense probably damaging 1.00
R5849:Lcn9 UTSW 2 25823256 critical splice donor site probably null
R6059:Lcn9 UTSW 2 25824725 missense possibly damaging 0.62
R7748:Lcn9 UTSW 2 25824914 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACCCTATCTGTTTGGGAATCC -3'
(R):5'- TTCACATACCAGAAGGCCTG -3'

Sequencing Primer
(F):5'- CACTGGGAGGGCATCTTC -3'
(R):5'- AGAAGGCCTGGCTGGTTC -3'
Posted On2015-06-10