Incidental Mutation 'R4199:Ifitm5'
ID318676
Institutional Source Beutler Lab
Gene Symbol Ifitm5
Ensembl Gene ENSMUSG00000025489
Gene Nameinterferon induced transmembrane protein 5
SynonymsHrmp1, Bril, 1110003J06Rik, fragilis4
MMRRC Submission 041029-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R4199 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140948958-140950291 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 140949236 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tyrosine at position 153 (*153Y)
Ref Sequence ENSEMBL: ENSMUSP00000148225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026562] [ENSMUST00000079403] [ENSMUST00000163094] [ENSMUST00000164580] [ENSMUST00000211129]
Predicted Effect probably null
Transcript: ENSMUST00000026562
AA Change: *135Y
SMART Domains Protein: ENSMUSP00000026562
Gene: ENSMUSG00000025489
AA Change: *135Y

DomainStartEndE-ValueType
Pfam:CD225 26 102 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079403
SMART Domains Protein: ENSMUSP00000078372
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164337
SMART Domains Protein: ENSMUSP00000127119
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 219 464 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164580
SMART Domains Protein: ENSMUSP00000128214
Gene: ENSMUSG00000062031

DomainStartEndE-ValueType
Pfam:Glyco_hydro_65m 279 496 3.6e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169736
Predicted Effect probably null
Transcript: ENSMUST00000211129
AA Change: *153Y
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein thought to play a role in bone mineralization. This gene is located on chromosome 11 in a cluster of related genes which are induced by interferon, however, this gene has not been shown to be interferon inducible. A similar gene, located in a gene cluster on mouse chromosome 7, is a member of the interferon-inducible fragilis gene family. The mouse gene encodes a transmembrane protein described as participating in germ cell competence. A mutation in the 5' UTR of this gene has been associated with osteogenesis imperfecta type V (PMID: 22863190, 22863195). [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice exhbit smaller skeletons, partial prenatal and postnatal lethality, and small litter sizes. Mice that survive to adulthood still exhibit shorter bones but other skeletal defects are no longer seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,661,048 probably benign Het
Cbarp G T 10: 80,135,492 H173Q probably damaging Het
Ccna1 G A 3: 55,047,315 A177V possibly damaging Het
Ces1f A G 8: 93,256,889 F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Disc1 C T 8: 125,148,459 T556I probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Dnmt1 A G 9: 20,938,118 S63P probably benign Het
Eml2 G A 7: 19,179,439 A121T probably benign Het
Eps8 T C 6: 137,514,327 N351S probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo34 T A 14: 47,530,997 W605R probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gal3st3 T A 19: 5,307,780 Y394* probably null Het
Gga1 A G 15: 78,889,075 E301G probably damaging Het
Ighg2b G T 12: 113,307,287 P110Q probably damaging Het
Il17rb C T 14: 29,996,644 D494N probably benign Het
Irf2bp2 C A 8: 126,591,574 A418S probably damaging Het
Lcn9 A G 2: 25,824,761 T171A probably benign Het
Lcorl T C 5: 45,733,788 K408E possibly damaging Het
Myh14 T A 7: 44,615,503 R1653* probably null Het
Naa16 A T 14: 79,355,871 H420Q probably damaging Het
Nol8 T A 13: 49,661,748 V426E possibly damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Papln C T 12: 83,783,392 T1012I probably null Het
Pkd1 A G 17: 24,570,030 T921A probably benign Het
Pknox1 C A 17: 31,602,816 Q294K probably damaging Het
Ppp2ca A G 11: 52,099,101 N18S probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Sfxn5 T A 6: 85,215,742 E319V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Spef2 A G 15: 9,667,280 F774S probably damaging Het
Syp A G X: 7,639,927 probably null Het
Zfp276 A G 8: 123,267,825 T544A probably damaging Het
Other mutations in Ifitm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ifitm5 APN 7 140950163 missense probably benign 0.43
R0265:Ifitm5 UTSW 7 140950008 intron probably benign
R4793:Ifitm5 UTSW 7 140950164 missense probably benign 0.01
R5031:Ifitm5 UTSW 7 140950104 nonsense probably null
R6909:Ifitm5 UTSW 7 140949259 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AATCGTGAACAGAGGCTCGG -3'
(R):5'- AACATCTTGTTTCTGGTGCTGC -3'

Sequencing Primer
(F):5'- AAGCACTGAGGACCCTCTAGG -3'
(R):5'- ACTTGGAGGCTGCAAGGC -3'
Posted On2015-06-10