Incidental Mutation 'R4199:Zfp276'
ID318678
Institutional Source Beutler Lab
Gene Symbol Zfp276
Ensembl Gene ENSMUSG00000001065
Gene Namezinc finger protein (C2H2 type) 276
SynonymsD8Ertd370e, D8Ertd377e
MMRRC Submission 041029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4199 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123254195-123269745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123267825 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 544 (T544A)
Ref Sequence ENSEMBL: ENSMUSP00000001092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001092] [ENSMUST00000035495] [ENSMUST00000127664] [ENSMUST00000154450]
Predicted Effect probably damaging
Transcript: ENSMUST00000001092
AA Change: T544A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001092
Gene: ENSMUSG00000001065
AA Change: T544A

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.2e-13 PFAM
low complexity region 402 422 N/A INTRINSIC
ZnF_C2H2 434 458 2.24e-3 SMART
ZnF_C2H2 465 490 6.67e-2 SMART
ZnF_C2H2 496 518 1.38e-3 SMART
ZnF_C2H2 524 546 1.82e-3 SMART
ZnF_C2H2 554 577 4.79e-3 SMART
low complexity region 586 602 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035495
SMART Domains Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 78 100 N/A INTRINSIC
Pfam:Fanconi_A_N 167 520 3.7e-146 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 778 790 N/A INTRINSIC
low complexity region 1069 1079 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
Pfam:Fanconi_A 1246 1308 8.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126834
SMART Domains Protein: ENSMUSP00000116732
Gene: ENSMUSG00000032815

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 142 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147312
Predicted Effect probably benign
Transcript: ENSMUST00000154450
SMART Domains Protein: ENSMUSP00000119771
Gene: ENSMUSG00000001065

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
low complexity region 59 72 N/A INTRINSIC
Pfam:zf-AD 79 159 1.9e-14 PFAM
low complexity region 183 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211934
Predicted Effect probably benign
Transcript: ENSMUST00000213090
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,661,048 probably benign Het
Cbarp G T 10: 80,135,492 H173Q probably damaging Het
Ccna1 G A 3: 55,047,315 A177V possibly damaging Het
Ces1f A G 8: 93,256,889 F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Disc1 C T 8: 125,148,459 T556I probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Dnmt1 A G 9: 20,938,118 S63P probably benign Het
Eml2 G A 7: 19,179,439 A121T probably benign Het
Eps8 T C 6: 137,514,327 N351S probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo34 T A 14: 47,530,997 W605R probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gal3st3 T A 19: 5,307,780 Y394* probably null Het
Gga1 A G 15: 78,889,075 E301G probably damaging Het
Ifitm5 T A 7: 140,949,236 *153Y probably null Het
Ighg2b G T 12: 113,307,287 P110Q probably damaging Het
Il17rb C T 14: 29,996,644 D494N probably benign Het
Irf2bp2 C A 8: 126,591,574 A418S probably damaging Het
Lcn9 A G 2: 25,824,761 T171A probably benign Het
Lcorl T C 5: 45,733,788 K408E possibly damaging Het
Myh14 T A 7: 44,615,503 R1653* probably null Het
Naa16 A T 14: 79,355,871 H420Q probably damaging Het
Nol8 T A 13: 49,661,748 V426E possibly damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Papln C T 12: 83,783,392 T1012I probably null Het
Pkd1 A G 17: 24,570,030 T921A probably benign Het
Pknox1 C A 17: 31,602,816 Q294K probably damaging Het
Ppp2ca A G 11: 52,099,101 N18S probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Sfxn5 T A 6: 85,215,742 E319V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Spef2 A G 15: 9,667,280 F774S probably damaging Het
Syp A G X: 7,639,927 probably null Het
Other mutations in Zfp276
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00726:Zfp276 APN 8 123258337 missense probably benign 0.01
IGL02573:Zfp276 APN 8 123264997 missense probably damaging 1.00
IGL02729:Zfp276 APN 8 123267816 missense probably damaging 1.00
IGL02956:Zfp276 APN 8 123254744 missense probably damaging 1.00
IGL03019:Zfp276 APN 8 123267934 missense probably damaging 1.00
R0087:Zfp276 UTSW 8 123265047 missense probably damaging 1.00
R0386:Zfp276 UTSW 8 123259503 nonsense probably null
R1084:Zfp276 UTSW 8 123254723 missense probably damaging 0.99
R4506:Zfp276 UTSW 8 123264927 critical splice donor site probably null
R4584:Zfp276 UTSW 8 123268406 utr 3 prime probably benign
R4776:Zfp276 UTSW 8 123254884 missense probably benign
R4985:Zfp276 UTSW 8 123267907 missense probably damaging 1.00
R5017:Zfp276 UTSW 8 123264977 unclassified probably benign
R5018:Zfp276 UTSW 8 123264977 unclassified probably benign
R5115:Zfp276 UTSW 8 123264977 unclassified probably benign
R5116:Zfp276 UTSW 8 123264977 unclassified probably benign
R5412:Zfp276 UTSW 8 123255781 missense probably damaging 1.00
R5436:Zfp276 UTSW 8 123265282 unclassified probably benign
R5822:Zfp276 UTSW 8 123255718 missense probably benign
R6059:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
R6186:Zfp276 UTSW 8 123255933 nonsense probably null
R6947:Zfp276 UTSW 8 123254904 missense probably benign
R6975:Zfp276 UTSW 8 123256831 nonsense probably null
R7313:Zfp276 UTSW 8 123267823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTCTCGTCCACCAGATG -3'
(R):5'- TCACCTGCTGAGTTCAAGCC -3'

Sequencing Primer
(F):5'- ACCAGATGCGCCACTCG -3'
(R):5'- TGAGTTCAAGCCGCTCAAG -3'
Posted On2015-06-10