Incidental Mutation 'R4199:Dnmt1'
ID318681
Institutional Source Beutler Lab
Gene Symbol Dnmt1
Ensembl Gene ENSMUSG00000004099
Gene NameDNA methyltransferase (cytosine-5) 1
SynonymsMTase, Dnmt1o, Cxxc9, MommeD2
MMRRC Submission 041029-MU
Accession Numbers

Genbank: NM_010066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4199 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20907209-20959888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20938118 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 63 (S63P)
Ref Sequence ENSEMBL: ENSMUSP00000136669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004202] [ENSMUST00000177754] [ENSMUST00000178110] [ENSMUST00000216540]
Predicted Effect probably benign
Transcript: ENSMUST00000004202
AA Change: S182P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004202
Gene: ENSMUSG00000004099
AA Change: S182P

DomainStartEndE-ValueType
DMAP_binding 16 106 1.7e-13 SMART
low complexity region 121 143 N/A INTRINSIC
low complexity region 156 166 N/A INTRINSIC
low complexity region 180 194 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 306 328 N/A INTRINSIC
Pfam:DNMT1-RFD 405 540 4.8e-46 PFAM
low complexity region 610 625 N/A INTRINSIC
Pfam:zf-CXXC 648 694 2.7e-17 PFAM
low complexity region 701 711 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
BAH 758 884 4.62e-31 SMART
BAH 935 1103 1.79e-37 SMART
low complexity region 1110 1124 N/A INTRINSIC
Pfam:DNA_methylase 1142 1596 1.3e-49 PFAM
low complexity region 1600 1619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177754
AA Change: S63P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000136982
Gene: ENSMUSG00000004099
AA Change: S63P

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
low complexity region 61 75 N/A INTRINSIC
low complexity region 154 171 N/A INTRINSIC
low complexity region 187 209 N/A INTRINSIC
Pfam:DNMT1-RFD 286 421 3.4e-40 PFAM
low complexity region 491 506 N/A INTRINSIC
Pfam:zf-CXXC 529 575 2.3e-17 PFAM
low complexity region 582 592 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
BAH 639 765 4.62e-31 SMART
BAH 816 984 1.79e-37 SMART
low complexity region 991 1005 N/A INTRINSIC
Pfam:DNA_methylase 1023 1477 1.3e-49 PFAM
low complexity region 1481 1500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178110
AA Change: S63P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000136669
Gene: ENSMUSG00000004099
AA Change: S63P

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
low complexity region 38 48 N/A INTRINSIC
low complexity region 62 76 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
Pfam:DNMT1-RFD 287 422 2.6e-40 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:zf-CXXC 530 576 4.7e-17 PFAM
low complexity region 583 593 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
BAH 640 766 4.62e-31 SMART
BAH 817 985 1.79e-37 SMART
low complexity region 992 1006 N/A INTRINSIC
Pfam:DNA_methylase 1024 1478 8e-50 PFAM
low complexity region 1482 1501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216135
Predicted Effect probably benign
Transcript: ENSMUST00000216540
AA Change: S64P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a methyltransferase that preferentially methylates cytosines of CpG residues in hemimethylated DNA to generate fully methylated CpG base pairs during DNA replication. This enzyme plays roles in diverse cellular processes including cell cycle regulation, DNA repair, and telomere maintenance. The encoded protein is composed of an N-terminal domain with a nuclear localization sequence and replication fork-targeting domain, a DNA-binding CXXC domain, two bromo-adjacent homology domains, and a C-terminal catalytic domain. Mouse embryonic stem cells mutant for this gene are viable, but when introduced into the germ line, cause a recessive lethal phenotype with mutant embryos displaying stunted growth and developmental defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations causing partial or severe loss of function were homozygous lethal by embryonic day 9.5, with lack of appropriate genomic imprinting observed at several loci. [provided by MGI curators]
Allele List at MGI

All alleles(109) : Targeted, knock-out(5) Targeted, other(11) Gene trapped(92) Chemically induced(1)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,661,048 probably benign Het
Cbarp G T 10: 80,135,492 H173Q probably damaging Het
Ccna1 G A 3: 55,047,315 A177V possibly damaging Het
Ces1f A G 8: 93,256,889 F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Disc1 C T 8: 125,148,459 T556I probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Eml2 G A 7: 19,179,439 A121T probably benign Het
Eps8 T C 6: 137,514,327 N351S probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo34 T A 14: 47,530,997 W605R probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gal3st3 T A 19: 5,307,780 Y394* probably null Het
Gga1 A G 15: 78,889,075 E301G probably damaging Het
Ifitm5 T A 7: 140,949,236 *153Y probably null Het
Ighg2b G T 12: 113,307,287 P110Q probably damaging Het
Il17rb C T 14: 29,996,644 D494N probably benign Het
Irf2bp2 C A 8: 126,591,574 A418S probably damaging Het
Lcn9 A G 2: 25,824,761 T171A probably benign Het
Lcorl T C 5: 45,733,788 K408E possibly damaging Het
Myh14 T A 7: 44,615,503 R1653* probably null Het
Naa16 A T 14: 79,355,871 H420Q probably damaging Het
Nol8 T A 13: 49,661,748 V426E possibly damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Papln C T 12: 83,783,392 T1012I probably null Het
Pkd1 A G 17: 24,570,030 T921A probably benign Het
Pknox1 C A 17: 31,602,816 Q294K probably damaging Het
Ppp2ca A G 11: 52,099,101 N18S probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Sfxn5 T A 6: 85,215,742 E319V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Spef2 A G 15: 9,667,280 F774S probably damaging Het
Syp A G X: 7,639,927 probably null Het
Zfp276 A G 8: 123,267,825 T544A probably damaging Het
Other mutations in Dnmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dnmt1 APN 9 20910270 missense possibly damaging 0.94
IGL01093:Dnmt1 APN 9 20909785 missense possibly damaging 0.88
IGL01160:Dnmt1 APN 9 20917319 missense possibly damaging 0.90
IGL01704:Dnmt1 APN 9 20910180 missense probably damaging 1.00
IGL02105:Dnmt1 APN 9 20907882 missense unknown
IGL02124:Dnmt1 APN 9 20908549 missense probably damaging 1.00
IGL02188:Dnmt1 APN 9 20941738 nonsense probably null
IGL02409:Dnmt1 APN 9 20926497 missense probably benign 0.00
IGL02579:Dnmt1 APN 9 20918120 missense possibly damaging 0.79
IGL02625:Dnmt1 APN 9 20927146 missense probably benign 0.01
IGL02794:Dnmt1 APN 9 20936551 missense probably benign
IGL02795:Dnmt1 APN 9 20927111 missense probably benign 0.12
IGL02938:Dnmt1 APN 9 20941373 missense probably benign 0.23
IGL03245:Dnmt1 APN 9 20915760 missense probably damaging 0.99
IGL03303:Dnmt1 APN 9 20926710 missense probably benign
B5639:Dnmt1 UTSW 9 20907968 splice site probably benign
PIT4576001:Dnmt1 UTSW 9 20911775 missense probably benign 0.28
R0071:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0180:Dnmt1 UTSW 9 20908620 missense probably damaging 0.99
R0368:Dnmt1 UTSW 9 20941757 missense probably damaging 0.99
R0387:Dnmt1 UTSW 9 20918213 missense probably damaging 1.00
R0529:Dnmt1 UTSW 9 20911550 missense probably damaging 1.00
R0532:Dnmt1 UTSW 9 20918556 splice site probably benign
R0612:Dnmt1 UTSW 9 20918193 missense probably damaging 0.98
R1109:Dnmt1 UTSW 9 20922388 missense probably damaging 1.00
R1298:Dnmt1 UTSW 9 20941456 missense probably benign
R1345:Dnmt1 UTSW 9 20908518 missense probably damaging 1.00
R1472:Dnmt1 UTSW 9 20932176 missense probably benign 0.28
R1654:Dnmt1 UTSW 9 20936574 missense possibly damaging 0.75
R1817:Dnmt1 UTSW 9 20927126 missense probably benign
R1836:Dnmt1 UTSW 9 20918246 missense probably damaging 1.00
R1957:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R1958:Dnmt1 UTSW 9 20927146 missense probably benign 0.01
R2097:Dnmt1 UTSW 9 20909788 missense probably benign 0.00
R2145:Dnmt1 UTSW 9 20937155 splice site probably benign
R2326:Dnmt1 UTSW 9 20924146 splice site probably benign
R4456:Dnmt1 UTSW 9 20909842 missense probably damaging 1.00
R4518:Dnmt1 UTSW 9 20911978 missense probably benign 0.00
R4586:Dnmt1 UTSW 9 20926693 missense probably benign 0.05
R4836:Dnmt1 UTSW 9 20908558 missense probably damaging 1.00
R5014:Dnmt1 UTSW 9 20912254 missense probably benign 0.07
R5338:Dnmt1 UTSW 9 20952719 missense probably benign 0.44
R5385:Dnmt1 UTSW 9 20918480 missense probably damaging 1.00
R5579:Dnmt1 UTSW 9 20920205 missense probably damaging 1.00
R5645:Dnmt1 UTSW 9 20922147 missense probably damaging 1.00
R5719:Dnmt1 UTSW 9 20912595 missense possibly damaging 0.86
R5881:Dnmt1 UTSW 9 20952717 missense probably damaging 0.97
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6039:Dnmt1 UTSW 9 20926420 intron probably benign
R6143:Dnmt1 UTSW 9 20927134 missense probably benign 0.30
R6342:Dnmt1 UTSW 9 20909793 nonsense probably null
R6374:Dnmt1 UTSW 9 20924045 missense possibly damaging 0.73
R6953:Dnmt1 UTSW 9 20918526 missense probably benign
R6990:Dnmt1 UTSW 9 20915814 nonsense probably null
R7089:Dnmt1 UTSW 9 20908489 missense probably damaging 0.99
R7463:Dnmt1 UTSW 9 20912225 missense possibly damaging 0.86
R7522:Dnmt1 UTSW 9 20920202 missense probably damaging 0.99
R7695:Dnmt1 UTSW 9 20913985 missense probably null 1.00
X0026:Dnmt1 UTSW 9 20913914 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTACTATTTTCAAACCCACCG -3'
(R):5'- AAAGCCCTTCAGTCCTGGATAGG -3'

Sequencing Primer
(F):5'- GTAGCACAGTCCATCAACAGGTTG -3'
(R):5'- AGTCCTGGATAGGTGGGCC -3'
Posted On2015-06-10