Incidental Mutation 'R4199:Ighg2b'
ID318687
Institutional Source Beutler Lab
Gene Symbol Ighg2b
Ensembl Gene ENSMUSG00000076613
Gene Nameimmunoglobulin heavy constant gamma 2B
SynonymsIgG2b, gamma2b
MMRRC Submission 041029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4199 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113302965-113307933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113307287 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 110 (P110Q)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably damaging
Transcript: ENSMUST00000103418
AA Change: P110Q

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100214
Gene: ENSMUSG00000076613
AA Change: P110Q

DomainStartEndE-ValueType
IGc1 22 92 6.9e-16 SMART
low complexity region 108 121 N/A INTRINSIC
IG_like 145 220 4.02e-2 SMART
IGc1 251 324 1.64e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192188
AA Change: P110Q

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,661,048 probably benign Het
Cbarp G T 10: 80,135,492 H173Q probably damaging Het
Ccna1 G A 3: 55,047,315 A177V possibly damaging Het
Ces1f A G 8: 93,256,889 F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Disc1 C T 8: 125,148,459 T556I probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Dnmt1 A G 9: 20,938,118 S63P probably benign Het
Eml2 G A 7: 19,179,439 A121T probably benign Het
Eps8 T C 6: 137,514,327 N351S probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo34 T A 14: 47,530,997 W605R probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gal3st3 T A 19: 5,307,780 Y394* probably null Het
Gga1 A G 15: 78,889,075 E301G probably damaging Het
Ifitm5 T A 7: 140,949,236 *153Y probably null Het
Il17rb C T 14: 29,996,644 D494N probably benign Het
Irf2bp2 C A 8: 126,591,574 A418S probably damaging Het
Lcn9 A G 2: 25,824,761 T171A probably benign Het
Lcorl T C 5: 45,733,788 K408E possibly damaging Het
Myh14 T A 7: 44,615,503 R1653* probably null Het
Naa16 A T 14: 79,355,871 H420Q probably damaging Het
Nol8 T A 13: 49,661,748 V426E possibly damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Papln C T 12: 83,783,392 T1012I probably null Het
Pkd1 A G 17: 24,570,030 T921A probably benign Het
Pknox1 C A 17: 31,602,816 Q294K probably damaging Het
Ppp2ca A G 11: 52,099,101 N18S probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Sfxn5 T A 6: 85,215,742 E319V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Spef2 A G 15: 9,667,280 F774S probably damaging Het
Syp A G X: 7,639,927 probably null Het
Zfp276 A G 8: 123,267,825 T544A probably damaging Het
Other mutations in Ighg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ighg2b APN 12 113307036 missense possibly damaging 0.79
IGL01837:Ighg2b APN 12 113306445 missense unknown
IGL01973:Ighg2b APN 12 113307685 missense unknown
IGL01998:Ighg2b APN 12 113307089 missense unknown
IGL02147:Ighg2b APN 12 113306391 makesense probably null
IGL02183:Ighg2b APN 12 113307829 missense unknown
IGL03089:Ighg2b APN 12 113306678 missense probably damaging 1.00
PIT4453001:Ighg2b UTSW 12 113306872 missense unknown
R4459:Ighg2b UTSW 12 113306958 missense unknown
R4577:Ighg2b UTSW 12 113306892 missense unknown
R4589:Ighg2b UTSW 12 113306484 missense unknown
R4807:Ighg2b UTSW 12 113304345 unclassified probably benign
R4822:Ighg2b UTSW 12 113306391 makesense probably null
R5424:Ighg2b UTSW 12 113307930 missense unknown
R5641:Ighg2b UTSW 12 113307147 missense unknown
R6297:Ighg2b UTSW 12 113306892 missense unknown
R6701:Ighg2b UTSW 12 113307079 missense unknown
R6703:Ighg2b UTSW 12 113305033 unclassified probably benign
R6880:Ighg2b UTSW 12 113307106 missense
R7342:Ighg2b UTSW 12 113306430 missense
R7505:Ighg2b UTSW 12 113304980 missense
R7908:Ighg2b UTSW 12 113306454 missense
R7989:Ighg2b UTSW 12 113306454 missense
Predicted Primers PCR Primer
(F):5'- TCAGGGAGATCATGAGTACATCC -3'
(R):5'- GGGAACATCTAGCTATGACCACC -3'

Sequencing Primer
(F):5'- ACATCCTTGATATTTGGAGGGAAG -3'
(R):5'- TAGCTATGACCACCTACACTCAAGG -3'
Posted On2015-06-10