Incidental Mutation 'R4199:Serpinb9d'
ID318688
Institutional Source Beutler Lab
Gene Symbol Serpinb9d
Ensembl Gene ENSMUSG00000054266
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9d
SynonymsAT2, ovalbumin, Spi9
MMRRC Submission 041029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4199 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33192959-33203129 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 33202674 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067198]
Predicted Effect probably null
Transcript: ENSMUST00000067198
SMART Domains Protein: ENSMUSP00000067710
Gene: ENSMUSG00000054266

DomainStartEndE-ValueType
SERPIN 13 377 1.79e-167 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,661,048 probably benign Het
Cbarp G T 10: 80,135,492 H173Q probably damaging Het
Ccna1 G A 3: 55,047,315 A177V possibly damaging Het
Ces1f A G 8: 93,256,889 F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Disc1 C T 8: 125,148,459 T556I probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Dnmt1 A G 9: 20,938,118 S63P probably benign Het
Eml2 G A 7: 19,179,439 A121T probably benign Het
Eps8 T C 6: 137,514,327 N351S probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo34 T A 14: 47,530,997 W605R probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gal3st3 T A 19: 5,307,780 Y394* probably null Het
Gga1 A G 15: 78,889,075 E301G probably damaging Het
Ifitm5 T A 7: 140,949,236 *153Y probably null Het
Ighg2b G T 12: 113,307,287 P110Q probably damaging Het
Il17rb C T 14: 29,996,644 D494N probably benign Het
Irf2bp2 C A 8: 126,591,574 A418S probably damaging Het
Lcn9 A G 2: 25,824,761 T171A probably benign Het
Lcorl T C 5: 45,733,788 K408E possibly damaging Het
Myh14 T A 7: 44,615,503 R1653* probably null Het
Naa16 A T 14: 79,355,871 H420Q probably damaging Het
Nol8 T A 13: 49,661,748 V426E possibly damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Papln C T 12: 83,783,392 T1012I probably null Het
Pkd1 A G 17: 24,570,030 T921A probably benign Het
Pknox1 C A 17: 31,602,816 Q294K probably damaging Het
Ppp2ca A G 11: 52,099,101 N18S probably benign Het
Sfxn5 T A 6: 85,215,742 E319V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Spef2 A G 15: 9,667,280 F774S probably damaging Het
Syp A G X: 7,639,927 probably null Het
Zfp276 A G 8: 123,267,825 T544A probably damaging Het
Other mutations in Serpinb9d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Serpinb9d APN 13 33202671 splice site probably null
IGL01610:Serpinb9d APN 13 33198002 missense probably benign 0.12
IGL01702:Serpinb9d APN 13 33203023 missense probably damaging 1.00
IGL01833:Serpinb9d APN 13 33200705 missense probably damaging 1.00
IGL02029:Serpinb9d APN 13 33196529 missense possibly damaging 0.74
IGL03013:Serpinb9d APN 13 33196538 missense probably damaging 1.00
IGL03027:Serpinb9d APN 13 33202715 nonsense probably null
IGL03056:Serpinb9d APN 13 33202753 missense probably damaging 1.00
IGL03189:Serpinb9d APN 13 33202912 missense probably damaging 1.00
IGL03206:Serpinb9d APN 13 33198031 missense possibly damaging 0.61
R0217:Serpinb9d UTSW 13 33198022 missense possibly damaging 0.79
R0370:Serpinb9d UTSW 13 33195966 missense probably damaging 1.00
R1174:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1175:Serpinb9d UTSW 13 33200625 missense probably benign 0.23
R1711:Serpinb9d UTSW 13 33200748 missense probably benign 0.03
R1716:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R1874:Serpinb9d UTSW 13 33197963 splice site probably null
R2186:Serpinb9d UTSW 13 33203047 missense possibly damaging 0.82
R2497:Serpinb9d UTSW 13 33196517 missense probably damaging 1.00
R4198:Serpinb9d UTSW 13 33202674 splice site probably null
R4198:Serpinb9d UTSW 13 33202965 missense probably benign 0.01
R4584:Serpinb9d UTSW 13 33200616 missense probably damaging 1.00
R4650:Serpinb9d UTSW 13 33202853 missense probably benign 0.00
R5573:Serpinb9d UTSW 13 33196440 critical splice acceptor site probably null
R5627:Serpinb9d UTSW 13 33202693 missense probably damaging 1.00
R6336:Serpinb9d UTSW 13 33194694 missense probably damaging 1.00
R6706:Serpinb9d UTSW 13 33196558 missense probably benign
R6948:Serpinb9d UTSW 13 33200723 missense possibly damaging 0.95
R7271:Serpinb9d UTSW 13 33194634 missense probably benign 0.43
R7336:Serpinb9d UTSW 13 33200719 missense probably benign 0.00
R7436:Serpinb9d UTSW 13 33195933 missense probably benign 0.35
R7675:Serpinb9d UTSW 13 33202776 nonsense probably null
R7874:Serpinb9d UTSW 13 33202671 splice site probably null
R7957:Serpinb9d UTSW 13 33202671 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAATACAGCCAGATAGCCCTG -3'
(R):5'- TGATAAGTCAGCCTTGCTTCC -3'

Sequencing Primer
(F):5'- AGATAGCCCTGCCCTGTACTG -3'
(R):5'- TAAGTCAGCCTTGCTTCCATCAAAG -3'
Posted On2015-06-10