Incidental Mutation 'R4199:Nol8'
ID 318689
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Name nucleolar protein 8
Synonyms D13Ertd548e, 4921532D18Rik, 5730412B09Rik
MMRRC Submission 041029-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4199 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 49806554-49832492 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49815224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 426 (V426E)
Ref Sequence ENSEMBL: ENSMUSP00000152878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223264] [ENSMUST00000223467]
AlphaFold Q3UHX0
Predicted Effect possibly damaging
Transcript: ENSMUST00000021824
AA Change: V444E

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: V444E

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221083
Predicted Effect possibly damaging
Transcript: ENSMUST00000221142
AA Change: V426E

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222197
AA Change: V444E

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000222333
Predicted Effect probably benign
Transcript: ENSMUST00000223264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223346
Predicted Effect possibly damaging
Transcript: ENSMUST00000223467
AA Change: V426E

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,794,101 (GRCm39) probably benign Het
Cbarp G T 10: 79,971,326 (GRCm39) H173Q probably damaging Het
Ccna1 G A 3: 54,954,736 (GRCm39) A177V possibly damaging Het
Ces1f A G 8: 93,983,517 (GRCm39) F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 24,991,095 (GRCm39) probably null Het
Disc1 C T 8: 125,875,198 (GRCm39) T556I probably damaging Het
Dnah3 C T 7: 119,522,061 (GRCm39) G4033D probably damaging Het
Dnmt1 A G 9: 20,849,414 (GRCm39) S63P probably benign Het
Eml2 G A 7: 18,913,364 (GRCm39) A121T probably benign Het
Eps8 T C 6: 137,491,325 (GRCm39) N351S probably damaging Het
Fbxo34 T A 14: 47,768,454 (GRCm39) W605R probably damaging Het
Foxg1 T A 12: 49,432,082 (GRCm39) S272T possibly damaging Het
Gal3st3 T A 19: 5,357,808 (GRCm39) Y394* probably null Het
Gga1 A G 15: 78,773,275 (GRCm39) E301G probably damaging Het
Ifitm5 T A 7: 140,529,149 (GRCm39) *153Y probably null Het
Ighg2b G T 12: 113,270,907 (GRCm39) P110Q probably damaging Het
Il17rb C T 14: 29,718,601 (GRCm39) D494N probably benign Het
Irf2bp2 C A 8: 127,318,313 (GRCm39) A418S probably damaging Het
Lcn9 A G 2: 25,714,773 (GRCm39) T171A probably benign Het
Lcorl T C 5: 45,891,130 (GRCm39) K408E possibly damaging Het
Myh14 T A 7: 44,264,927 (GRCm39) R1653* probably null Het
Naa16 A T 14: 79,593,311 (GRCm39) H420Q probably damaging Het
Or1i2 A T 10: 78,447,901 (GRCm39) D191E possibly damaging Het
Orc4 G A 2: 48,827,501 (GRCm39) P31S probably benign Het
Pabir3 G A X: 52,382,376 (GRCm39) R94H possibly damaging Het
Papln C T 12: 83,830,166 (GRCm39) T1012I probably null Het
Pkd1 A G 17: 24,789,004 (GRCm39) T921A probably benign Het
Pknox1 C A 17: 31,821,790 (GRCm39) Q294K probably damaging Het
Ppp2ca A G 11: 51,989,928 (GRCm39) N18S probably benign Het
Serpinb9d A G 13: 33,386,657 (GRCm39) probably null Het
Sfxn5 T A 6: 85,192,724 (GRCm39) E319V probably benign Het
Slc1a1 A G 19: 28,878,852 (GRCm39) K197R probably benign Het
Spef2 A G 15: 9,667,366 (GRCm39) F774S probably damaging Het
Syp A G X: 7,506,166 (GRCm39) probably null Het
Zfp276 A G 8: 123,994,564 (GRCm39) T544A probably damaging Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49,815,704 (GRCm39) missense probably benign 0.01
IGL01106:Nol8 APN 13 49,807,957 (GRCm39) missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49,813,428 (GRCm39) missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49,815,146 (GRCm39) missense probably benign 0.06
IGL01670:Nol8 APN 13 49,814,784 (GRCm39) missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49,828,883 (GRCm39) missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49,826,248 (GRCm39) missense probably benign
IGL02212:Nol8 APN 13 49,815,626 (GRCm39) missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49,808,721 (GRCm39) splice site probably benign
IGL02645:Nol8 APN 13 49,818,947 (GRCm39) critical splice donor site probably null
IGL02949:Nol8 APN 13 49,815,878 (GRCm39) missense probably benign 0.01
IGL02954:Nol8 APN 13 49,814,648 (GRCm39) missense probably benign 0.01
IGL03182:Nol8 APN 13 49,817,557 (GRCm39) missense probably damaging 1.00
IGL03406:Nol8 APN 13 49,815,044 (GRCm39) missense probably damaging 1.00
P0047:Nol8 UTSW 13 49,807,824 (GRCm39) splice site probably null
R0092:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R0099:Nol8 UTSW 13 49,826,165 (GRCm39) missense probably benign
R0145:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49,807,921 (GRCm39) missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49,815,628 (GRCm39) missense probably damaging 1.00
R0617:Nol8 UTSW 13 49,807,921 (GRCm39) missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49,830,234 (GRCm39) missense probably benign 0.05
R0637:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R1246:Nol8 UTSW 13 49,830,245 (GRCm39) missense probably damaging 1.00
R1446:Nol8 UTSW 13 49,808,703 (GRCm39) missense probably damaging 1.00
R1464:Nol8 UTSW 13 49,830,264 (GRCm39) missense probably benign
R1464:Nol8 UTSW 13 49,830,264 (GRCm39) missense probably benign
R1627:Nol8 UTSW 13 49,814,980 (GRCm39) missense probably benign 0.01
R1703:Nol8 UTSW 13 49,820,933 (GRCm39) missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49,820,884 (GRCm39) missense probably benign 0.06
R2187:Nol8 UTSW 13 49,815,475 (GRCm39) missense probably benign 0.00
R2357:Nol8 UTSW 13 49,807,980 (GRCm39) critical splice donor site probably null
R3081:Nol8 UTSW 13 49,831,868 (GRCm39) unclassified probably benign
R3969:Nol8 UTSW 13 49,813,492 (GRCm39) nonsense probably null
R4720:Nol8 UTSW 13 49,816,229 (GRCm39) missense probably damaging 1.00
R4927:Nol8 UTSW 13 49,807,901 (GRCm39) missense possibly damaging 0.79
R5177:Nol8 UTSW 13 49,814,588 (GRCm39) missense probably benign 0.32
R5512:Nol8 UTSW 13 49,830,263 (GRCm39) missense probably benign
R5744:Nol8 UTSW 13 49,815,802 (GRCm39) missense possibly damaging 0.82
R5988:Nol8 UTSW 13 49,826,090 (GRCm39) missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49,807,160 (GRCm39) critical splice donor site probably null
R6306:Nol8 UTSW 13 49,829,829 (GRCm39) missense probably damaging 1.00
R6359:Nol8 UTSW 13 49,817,546 (GRCm39) missense probably benign 0.16
R6378:Nol8 UTSW 13 49,820,831 (GRCm39) missense probably damaging 1.00
R6655:Nol8 UTSW 13 49,807,868 (GRCm39) missense probably damaging 1.00
R7035:Nol8 UTSW 13 49,814,678 (GRCm39) missense probably benign 0.06
R7058:Nol8 UTSW 13 49,829,862 (GRCm39) missense probably damaging 1.00
R7368:Nol8 UTSW 13 49,814,695 (GRCm39) missense probably benign 0.00
R7450:Nol8 UTSW 13 49,813,491 (GRCm39) missense probably benign 0.01
R7673:Nol8 UTSW 13 49,818,256 (GRCm39) missense probably benign 0.15
R7750:Nol8 UTSW 13 49,815,742 (GRCm39) missense possibly damaging 0.83
R8246:Nol8 UTSW 13 49,808,724 (GRCm39) splice site probably benign
R9081:Nol8 UTSW 13 49,814,881 (GRCm39) missense probably benign 0.00
R9127:Nol8 UTSW 13 49,815,475 (GRCm39) missense probably benign 0.00
R9223:Nol8 UTSW 13 49,814,738 (GRCm39) missense possibly damaging 0.63
X0020:Nol8 UTSW 13 49,814,641 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTAAGCCTAGGAAATAACCATG -3'
(R):5'- TGTGGACCATTAGTCTCACTG -3'

Sequencing Primer
(F):5'- AAGCCTAGGAAATAACCATGAATATG -3'
(R):5'- AGTCTCACTGTCTTTTCCTGGAAAC -3'
Posted On 2015-06-10