Mutagenetix > Incidental Mutation

Incidental Mutation 'R4199:Nol8'

318689

Institutional Source

Beutler Lab

Gene Symbol

Nol8

Ensembl Gene

ENSMUSG00000021392

Gene Name

nucleolar protein 8

Synonyms

5730412B09Rik, D13Ertd548e, 4921532D18Rik

MMRRC Submission

041029-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4199 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49653078-49679016 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 49661748 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 426 (V426E)

Ref Sequence

ENSEMBL: ENSMUSP00000152878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223264] [ENSMUST00000223467]

AlphaFold

Q3UHX0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021824
AA Change: V444E

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: V444E

Domain	Start	End	E-Value	Type
RRM	27	103	3.02e-9	SMART
low complexity region	315	327	N/A	INTRINSIC
low complexity region	454	468	N/A	INTRINSIC
low complexity region	712	724	N/A	INTRINSIC
low complexity region	804	816	N/A	INTRINSIC
low complexity region	836	849	N/A	INTRINSIC
coiled coil region	886	916	N/A	INTRINSIC
coiled coil region	955	981	N/A	INTRINSIC
low complexity region	1080	1093	N/A	INTRINSIC
low complexity region	1152	1164	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000221083

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221142
AA Change: V426E

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222197
AA Change: V444E

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000222333

Predicted Effect

probably benign
Transcript: ENSMUST00000223264

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223346

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223467
AA Change: V426E

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankhd1	C	G	18: 36,661,048		probably benign	Het
Cbarp	G	T	10: 80,135,492	H173Q	probably damaging	Het
Ccna1	G	A	3: 55,047,315	A177V	possibly damaging	Het
Ces1f	A	G	8: 93,256,889	F497L	probably benign	Het
Cic	TCCCCC	TCCCCCCC	7: 25,291,670		probably null	Het
Disc1	C	T	8: 125,148,459	T556I	probably damaging	Het
Dnah3	C	T	7: 119,922,838	G4033D	probably damaging	Het
Dnmt1	A	G	9: 20,938,118	S63P	probably benign	Het
Eml2	G	A	7: 19,179,439	A121T	probably benign	Het
Eps8	T	C	6: 137,514,327	N351S	probably damaging	Het
Fam122c	G	A	X: 53,293,499	R94H	possibly damaging	Het
Fbxo34	T	A	14: 47,530,997	W605R	probably damaging	Het
Foxg1	T	A	12: 49,385,299	S272T	possibly damaging	Het
Gal3st3	T	A	19: 5,307,780	Y394*	probably null	Het
Gga1	A	G	15: 78,889,075	E301G	probably damaging	Het
Ifitm5	T	A	7: 140,949,236	*153Y	probably null	Het
Ighg2b	G	T	12: 113,307,287	P110Q	probably damaging	Het
Il17rb	C	T	14: 29,996,644	D494N	probably benign	Het
Irf2bp2	C	A	8: 126,591,574	A418S	probably damaging	Het
Lcn9	A	G	2: 25,824,761	T171A	probably benign	Het
Lcorl	T	C	5: 45,733,788	K408E	possibly damaging	Het
Myh14	T	A	7: 44,615,503	R1653*	probably null	Het
Naa16	A	T	14: 79,355,871	H420Q	probably damaging	Het
Olfr1357	A	T	10: 78,612,067	D191E	possibly damaging	Het
Orc4	G	A	2: 48,937,489	P31S	probably benign	Het
Papln	C	T	12: 83,783,392	T1012I	probably null	Het
Pkd1	A	G	17: 24,570,030	T921A	probably benign	Het
Pknox1	C	A	17: 31,602,816	Q294K	probably damaging	Het
Ppp2ca	A	G	11: 52,099,101	N18S	probably benign	Het
Serpinb9d	A	G	13: 33,202,674		probably null	Het
Sfxn5	T	A	6: 85,215,742	E319V	probably benign	Het
Slc1a1	A	G	19: 28,901,452	K197R	probably benign	Het
Spef2	A	G	15: 9,667,280	F774S	probably damaging	Het
Syp	A	G	X: 7,639,927		probably null	Het
Zfp276	A	G	8: 123,267,825	T544A	probably damaging	Het

Other mutations in Nol8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Nol8	APN	13	49662228	missense	probably benign	0.01
IGL01106:Nol8	APN	13	49654481	missense	possibly damaging	0.46
IGL01413:Nol8	APN	13	49659952	missense	possibly damaging	0.82
IGL01540:Nol8	APN	13	49661670	missense	probably benign	0.06
IGL01670:Nol8	APN	13	49661308	missense	possibly damaging	0.54
IGL01672:Nol8	APN	13	49675407	missense	possibly damaging	0.95
IGL02032:Nol8	APN	13	49672772	missense	probably benign
IGL02212:Nol8	APN	13	49662150	missense	possibly damaging	0.87
IGL02323:Nol8	APN	13	49655245	splice site	probably benign
IGL02645:Nol8	APN	13	49665471	critical splice donor site	probably null
IGL02949:Nol8	APN	13	49662402	missense	probably benign	0.01
IGL02954:Nol8	APN	13	49661172	missense	probably benign	0.01
IGL03182:Nol8	APN	13	49664081	missense	probably damaging	1.00
IGL03406:Nol8	APN	13	49661568	missense	probably damaging	1.00
P0047:Nol8	UTSW	13	49654348	splice site	probably null
R0092:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0099:Nol8	UTSW	13	49672689	missense	probably benign
R0145:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0269:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0370:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0374:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R0390:Nol8	UTSW	13	49662152	missense	probably damaging	1.00
R0617:Nol8	UTSW	13	49654445	missense	possibly damaging	0.49
R0635:Nol8	UTSW	13	49676758	missense	probably benign	0.05
R0637:Nol8	UTSW	13	49662447	missense	possibly damaging	0.54
R1246:Nol8	UTSW	13	49676769	missense	probably damaging	1.00
R1446:Nol8	UTSW	13	49655227	missense	probably damaging	1.00
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1464:Nol8	UTSW	13	49676788	missense	probably benign
R1627:Nol8	UTSW	13	49661504	missense	probably benign	0.01
R1703:Nol8	UTSW	13	49667457	missense	possibly damaging	0.65
R1751:Nol8	UTSW	13	49667408	missense	probably benign	0.06
R2187:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R2357:Nol8	UTSW	13	49654504	critical splice donor site	probably null
R3081:Nol8	UTSW	13	49678392	unclassified	probably benign
R3969:Nol8	UTSW	13	49660016	nonsense	probably null
R4720:Nol8	UTSW	13	49662753	missense	probably damaging	1.00
R4927:Nol8	UTSW	13	49654425	missense	possibly damaging	0.79
R5177:Nol8	UTSW	13	49661112	missense	probably benign	0.32
R5512:Nol8	UTSW	13	49676787	missense	probably benign
R5744:Nol8	UTSW	13	49662326	missense	possibly damaging	0.82
R5988:Nol8	UTSW	13	49672614	missense	possibly damaging	0.58
R6048:Nol8	UTSW	13	49653684	critical splice donor site	probably null
R6306:Nol8	UTSW	13	49676353	missense	probably damaging	1.00
R6359:Nol8	UTSW	13	49664070	missense	probably benign	0.16
R6378:Nol8	UTSW	13	49667355	missense	probably damaging	1.00
R6655:Nol8	UTSW	13	49654392	missense	probably damaging	1.00
R7035:Nol8	UTSW	13	49661202	missense	probably benign	0.06
R7058:Nol8	UTSW	13	49676386	missense	probably damaging	1.00
R7368:Nol8	UTSW	13	49661219	missense	probably benign	0.00
R7450:Nol8	UTSW	13	49660015	missense	probably benign	0.01
R7673:Nol8	UTSW	13	49664780	missense	probably benign	0.15
R7750:Nol8	UTSW	13	49662266	missense	possibly damaging	0.83
R8246:Nol8	UTSW	13	49655248	splice site	probably benign
R9081:Nol8	UTSW	13	49661405	missense	probably benign	0.00
R9127:Nol8	UTSW	13	49661999	missense	probably benign	0.00
R9223:Nol8	UTSW	13	49661262	missense	possibly damaging	0.63
X0020:Nol8	UTSW	13	49661165	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAGTAAGCCTAGGAAATAACCATG -3'
(R):5'- TGTGGACCATTAGTCTCACTG -3'

Sequencing Primer
(F):5'- AAGCCTAGGAAATAACCATGAATATG -3'
(R):5'- AGTCTCACTGTCTTTTCCTGGAAAC -3'

Posted On

2015-06-10