Incidental Mutation 'R4199:Il17rb'
ID318690
Institutional Source Beutler Lab
Gene Symbol Il17rb
Ensembl Gene ENSMUSG00000015966
Gene Nameinterleukin 17 receptor B
SynonymsIL17RH1, Evi27, IL-17Rh1, IL-17ER, Il17br
MMRRC Submission 041029-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4199 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location29996135-30008896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29996644 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 494 (D494N)
Ref Sequence ENSEMBL: ENSMUSP00000113686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016110] [ENSMUST00000016115] [ENSMUST00000122205] [ENSMUST00000135888] [ENSMUST00000136726] [ENSMUST00000224797]
Predicted Effect probably benign
Transcript: ENSMUST00000016110
AA Change: D494N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016110
Gene: ENSMUSG00000015966
AA Change: D494N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 175 4.3e-26 PFAM
Pfam:IL17R_fnIII_D2 176 268 1.3e-11 PFAM
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016115
SMART Domains Protein: ENSMUSP00000016115
Gene: ENSMUSG00000015971

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
ACTIN 46 621 3.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122205
AA Change: D494N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113686
Gene: ENSMUSG00000015966
AA Change: D494N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PDB:4HSA|F 34 276 2e-23 PDB
transmembrane domain 287 309 N/A INTRINSIC
Pfam:SEFIR 329 476 1.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135888
SMART Domains Protein: ENSMUSP00000121407
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 22 123 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136726
SMART Domains Protein: ENSMUSP00000117802
Gene: ENSMUSG00000015966

DomainStartEndE-ValueType
PDB:3JVF|C 13 171 5e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223643
Predicted Effect probably benign
Transcript: ENSMUST00000224797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225746
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor. This receptor specifically binds to IL17B and IL17E, but does not bind to IL17 and IL17C. This receptor has been shown to mediate the activation of NF-kappaB and the production of IL8 induced by IL17E. The expression of the rat counterpart of this gene was found to be significantly up-regulated during intestinal inflammation, which suggested the immunoregulatory activity of this receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are homozygous for a null allele have defects in their response to IL17A or IL17F. In addition this locus is a common site of retoviral integration in BXH2 murine myeloid leukemias and occurred at a CpG island 6 kb upstream of the Il17rb gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,661,048 probably benign Het
Cbarp G T 10: 80,135,492 H173Q probably damaging Het
Ccna1 G A 3: 55,047,315 A177V possibly damaging Het
Ces1f A G 8: 93,256,889 F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Disc1 C T 8: 125,148,459 T556I probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Dnmt1 A G 9: 20,938,118 S63P probably benign Het
Eml2 G A 7: 19,179,439 A121T probably benign Het
Eps8 T C 6: 137,514,327 N351S probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo34 T A 14: 47,530,997 W605R probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gal3st3 T A 19: 5,307,780 Y394* probably null Het
Gga1 A G 15: 78,889,075 E301G probably damaging Het
Ifitm5 T A 7: 140,949,236 *153Y probably null Het
Ighg2b G T 12: 113,307,287 P110Q probably damaging Het
Irf2bp2 C A 8: 126,591,574 A418S probably damaging Het
Lcn9 A G 2: 25,824,761 T171A probably benign Het
Lcorl T C 5: 45,733,788 K408E possibly damaging Het
Myh14 T A 7: 44,615,503 R1653* probably null Het
Naa16 A T 14: 79,355,871 H420Q probably damaging Het
Nol8 T A 13: 49,661,748 V426E possibly damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Papln C T 12: 83,783,392 T1012I probably null Het
Pkd1 A G 17: 24,570,030 T921A probably benign Het
Pknox1 C A 17: 31,602,816 Q294K probably damaging Het
Ppp2ca A G 11: 52,099,101 N18S probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Sfxn5 T A 6: 85,215,742 E319V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Spef2 A G 15: 9,667,280 F774S probably damaging Het
Syp A G X: 7,639,927 probably null Het
Zfp276 A G 8: 123,267,825 T544A probably damaging Het
Other mutations in Il17rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Il17rb APN 14 30003680 missense probably damaging 1.00
IGL03151:Il17rb APN 14 30006853 missense probably benign 0.05
R0276:Il17rb UTSW 14 30004380 missense probably damaging 1.00
R0391:Il17rb UTSW 14 30004347 missense probably benign 0.00
R0391:Il17rb UTSW 14 30006155 unclassified probably null
R0408:Il17rb UTSW 14 29996680 missense probably benign 0.02
R2011:Il17rb UTSW 14 29996840 nonsense probably null
R2012:Il17rb UTSW 14 29996840 nonsense probably null
R2057:Il17rb UTSW 14 29997154 missense probably benign 0.01
R2227:Il17rb UTSW 14 30006081 missense probably benign 0.02
R3548:Il17rb UTSW 14 30008772 unclassified probably null
R4578:Il17rb UTSW 14 30002399 missense probably damaging 0.97
R5092:Il17rb UTSW 14 30002376 missense probably benign 0.00
R5928:Il17rb UTSW 14 30004275 critical splice donor site probably null
R6280:Il17rb UTSW 14 30002971 missense probably benign 0.00
R6378:Il17rb UTSW 14 30000363 missense probably damaging 0.97
R6470:Il17rb UTSW 14 30002909 missense probably benign 0.10
R6741:Il17rb UTSW 14 30000336 missense possibly damaging 0.82
R6919:Il17rb UTSW 14 30004271 splice site probably null
R7133:Il17rb UTSW 14 29996871 missense probably damaging 1.00
R7423:Il17rb UTSW 14 29997115 missense probably damaging 0.97
R7470:Il17rb UTSW 14 29998033 missense probably damaging 1.00
R7559:Il17rb UTSW 14 29997043 missense probably damaging 1.00
R7847:Il17rb UTSW 14 29996806 missense probably damaging 1.00
R7930:Il17rb UTSW 14 29996806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAATGACTAGCCTCAGG -3'
(R):5'- TTGTAGTGATTTCAGCAGCCAGAC -3'

Sequencing Primer
(F):5'- CTCAGGCGTGTATGCTCAG -3'
(R):5'- CGCATCTGCACAAATACCTGGTG -3'
Posted On2015-06-10