Incidental Mutation 'R4199:Gga1'
ID318694
Institutional Source Beutler Lab
Gene Symbol Gga1
Ensembl Gene ENSMUSG00000033128
Gene Namegolgi associated, gamma adaptin ear containing, ARF binding protein 1
Synonyms4930406E12Rik
MMRRC Submission 041029-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock #R4199 (G1)
Quality Score154
Status Not validated
Chromosome15
Chromosomal Location78877190-78894585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78889075 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 301 (E301G)
Ref Sequence ENSEMBL: ENSMUSP00000035992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041587] [ENSMUST00000230192]
Predicted Effect probably damaging
Transcript: ENSMUST00000041587
AA Change: E301G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035992
Gene: ENSMUSG00000033128
AA Change: E301G

DomainStartEndE-ValueType
VHS 10 143 9.89e-45 SMART
Pfam:GAT 222 299 1.4e-27 PFAM
low complexity region 313 340 N/A INTRINSIC
low complexity region 366 378 N/A INTRINSIC
low complexity region 419 425 N/A INTRINSIC
low complexity region 459 470 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
Alpha_adaptinC2 503 627 4.21e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229353
Predicted Effect possibly damaging
Transcript: ENSMUST00000230192
AA Change: E301G

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230772
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) protein family. Members of this family are ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele display decreased birth weight, slow postnatal weight gain, hypoglycemia, increased plasma levels of acid hydrolases, and partial neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,661,048 probably benign Het
Cbarp G T 10: 80,135,492 H173Q probably damaging Het
Ccna1 G A 3: 55,047,315 A177V possibly damaging Het
Ces1f A G 8: 93,256,889 F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Disc1 C T 8: 125,148,459 T556I probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Dnmt1 A G 9: 20,938,118 S63P probably benign Het
Eml2 G A 7: 19,179,439 A121T probably benign Het
Eps8 T C 6: 137,514,327 N351S probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fbxo34 T A 14: 47,530,997 W605R probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gal3st3 T A 19: 5,307,780 Y394* probably null Het
Ifitm5 T A 7: 140,949,236 *153Y probably null Het
Ighg2b G T 12: 113,307,287 P110Q probably damaging Het
Il17rb C T 14: 29,996,644 D494N probably benign Het
Irf2bp2 C A 8: 126,591,574 A418S probably damaging Het
Lcn9 A G 2: 25,824,761 T171A probably benign Het
Lcorl T C 5: 45,733,788 K408E possibly damaging Het
Myh14 T A 7: 44,615,503 R1653* probably null Het
Naa16 A T 14: 79,355,871 H420Q probably damaging Het
Nol8 T A 13: 49,661,748 V426E possibly damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Papln C T 12: 83,783,392 T1012I probably null Het
Pkd1 A G 17: 24,570,030 T921A probably benign Het
Pknox1 C A 17: 31,602,816 Q294K probably damaging Het
Ppp2ca A G 11: 52,099,101 N18S probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Sfxn5 T A 6: 85,215,742 E319V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Spef2 A G 15: 9,667,280 F774S probably damaging Het
Syp A G X: 7,639,927 probably null Het
Zfp276 A G 8: 123,267,825 T544A probably damaging Het
Other mutations in Gga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Gga1 APN 15 78883355 missense possibly damaging 0.68
IGL01921:Gga1 APN 15 78893795 missense possibly damaging 0.82
IGL02178:Gga1 APN 15 78892047 missense probably benign 0.00
IGL02697:Gga1 APN 15 78885346 missense probably damaging 1.00
IGL02931:Gga1 APN 15 78893322 missense possibly damaging 0.95
IGL03025:Gga1 APN 15 78888182 missense probably damaging 1.00
PIT4472001:Gga1 UTSW 15 78893636 missense probably damaging 1.00
PIT4585001:Gga1 UTSW 15 78893790 missense probably benign 0.37
R0838:Gga1 UTSW 15 78891918 missense probably damaging 1.00
R1167:Gga1 UTSW 15 78888170 missense probably damaging 1.00
R1620:Gga1 UTSW 15 78888470 missense probably damaging 1.00
R1757:Gga1 UTSW 15 78889030 missense probably damaging 1.00
R2128:Gga1 UTSW 15 78888448 missense probably damaging 1.00
R2438:Gga1 UTSW 15 78885298 missense probably damaging 1.00
R4050:Gga1 UTSW 15 78891491 missense probably benign 0.01
R4684:Gga1 UTSW 15 78885309 missense probably damaging 0.99
R5070:Gga1 UTSW 15 78892017 missense possibly damaging 0.57
R5579:Gga1 UTSW 15 78893188 missense probably damaging 1.00
R7340:Gga1 UTSW 15 78891451 missense probably benign 0.00
R7864:Gga1 UTSW 15 78888244 missense probably damaging 1.00
R7947:Gga1 UTSW 15 78888244 missense probably damaging 1.00
Z1088:Gga1 UTSW 15 78892021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTTTACAGCAGCCTG -3'
(R):5'- TCATGCGAGGAAGTGTCTTC -3'

Sequencing Primer
(F):5'- GCTGTCTGGACCCACATTTGG -3'
(R):5'- CCTTCTATTTCATGACAAACTTGGG -3'
Posted On2015-06-10