Incidental Mutation 'R4199:Fam122c'
ID318703
Institutional Source Beutler Lab
Gene Symbol Fam122c
Ensembl Gene ENSMUSG00000036013
Gene Namefamily with sequence similarity 122, member C
Synonyms
MMRRC Submission 041029-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4199 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location53273424-53331185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53293499 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 94 (R94H)
Ref Sequence ENSEMBL: ENSMUSP00000139776 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000114835
AA Change: R94H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000124137
AA Change: R94H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000186314
AA Change: R94H

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 C G 18: 36,661,048 probably benign Het
Cbarp G T 10: 80,135,492 H173Q probably damaging Het
Ccna1 G A 3: 55,047,315 A177V possibly damaging Het
Ces1f A G 8: 93,256,889 F497L probably benign Het
Cic TCCCCC TCCCCCCC 7: 25,291,670 probably null Het
Disc1 C T 8: 125,148,459 T556I probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Dnmt1 A G 9: 20,938,118 S63P probably benign Het
Eml2 G A 7: 19,179,439 A121T probably benign Het
Eps8 T C 6: 137,514,327 N351S probably damaging Het
Fbxo34 T A 14: 47,530,997 W605R probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gal3st3 T A 19: 5,307,780 Y394* probably null Het
Gga1 A G 15: 78,889,075 E301G probably damaging Het
Ifitm5 T A 7: 140,949,236 *153Y probably null Het
Ighg2b G T 12: 113,307,287 P110Q probably damaging Het
Il17rb C T 14: 29,996,644 D494N probably benign Het
Irf2bp2 C A 8: 126,591,574 A418S probably damaging Het
Lcn9 A G 2: 25,824,761 T171A probably benign Het
Lcorl T C 5: 45,733,788 K408E possibly damaging Het
Myh14 T A 7: 44,615,503 R1653* probably null Het
Naa16 A T 14: 79,355,871 H420Q probably damaging Het
Nol8 T A 13: 49,661,748 V426E possibly damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Papln C T 12: 83,783,392 T1012I probably null Het
Pkd1 A G 17: 24,570,030 T921A probably benign Het
Pknox1 C A 17: 31,602,816 Q294K probably damaging Het
Ppp2ca A G 11: 52,099,101 N18S probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Sfxn5 T A 6: 85,215,742 E319V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Spef2 A G 15: 9,667,280 F774S probably damaging Het
Syp A G X: 7,639,927 probably null Het
Zfp276 A G 8: 123,267,825 T544A probably damaging Het
Other mutations in Fam122c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4198:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4361:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4515:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4517:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4518:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4519:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4522:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4523:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4529:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4530:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4532:Fam122c UTSW X 53293499 missense possibly damaging 0.94
R4533:Fam122c UTSW X 53293499 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATTGCTGCTGTACACTCAATAAG -3'
(R):5'- GTAATCGGCTATGACTGCTTTTAG -3'

Sequencing Primer
(F):5'- GAATCAGGGTTTCTCTGTATAGCCC -3'
(R):5'- AAGCCTCCTGATGATGACCTG -3'
Posted On2015-06-10