Mutagenetix > Incidental Mutations

Incidental Mutation 'R4200:Aox3'

318704

Institutional Source

Beutler Lab

Gene Symbol

Aox3

Ensembl Gene

ENSMUSG00000064294

Gene Name

aldehyde oxidase 3

Synonyms

AOH1, 1200011D03Rik

MMRRC Submission

041030-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4200 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58113130-58200698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58188378 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1214 (E1214G)

Ref Sequence

ENSEMBL: ENSMUSP00000049391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040999]

PDB Structure

Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000040999
AA Change: E1214G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: E1214G

Domain	Start	End	E-Value	Type
Pfam:Fer2	12	82	1.4e-9	PFAM
Pfam:Fer2_2	91	165	1e-29	PFAM
Pfam:FAD_binding_5	239	419	1e-44	PFAM
CO_deh_flav_C	426	530	9.26e-24	SMART
Ald_Xan_dh_C	594	697	2.27e-41	SMART
Pfam:Ald_Xan_dh_C2	708	1241	8.7e-183	PFAM
low complexity region	1275	1286	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

100% (40/40)

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	T	A	3: 60,039,534	Y218N	probably damaging	Het
Arhgap31	G	A	16: 38,623,913	A194V	probably damaging	Het
Asxl1	C	A	2: 153,400,106	L859I	possibly damaging	Het
C7	A	G	15: 4,990,309		probably null	Het
Col6a3	C	A	1: 90,801,383	V1279L	probably benign	Het
Dnah3	C	T	7: 119,922,838	G4033D	probably damaging	Het
Etl4	C	A	2: 20,781,883	H481Q	probably damaging	Het
Foxg1	T	A	12: 49,385,299	S272T	possibly damaging	Het
Gm3336	A	T	8: 70,720,612	D91V	probably benign	Het
Hnf4g	T	G	3: 3,651,284	V256G	possibly damaging	Het
Hyou1	G	A	9: 44,388,859	R815H	probably damaging	Het
Ifi203	A	C	1: 173,924,115	I380S	probably damaging	Het
Map2	C	T	1: 66,425,298	R128C	probably damaging	Het
Mboat7	C	A	7: 3,685,753	A259S	possibly damaging	Het
Mroh8	C	T	2: 157,241,810	V381M	probably benign	Het
Muc5b	T	A	7: 141,858,925	C1869*	probably null	Het
Nfatc4	C	T	14: 55,832,032	R672W	probably damaging	Het
Nup210l	T	C	3: 90,119,911	I200T	probably damaging	Het
Olfr1357	A	T	10: 78,612,067	D191E	possibly damaging	Het
Olfr573-ps1	A	G	7: 102,941,797	F260S	probably damaging	Het
Olr1	A	G	6: 129,502,105	V50A	probably damaging	Het
Pcdhgb5	A	G	18: 37,731,982	I277V	possibly damaging	Het
Pknox1	C	A	17: 31,599,610	N272K	probably benign	Het
Psg23	T	C	7: 18,612,065	D235G	probably damaging	Het
Slc1a1	A	G	19: 28,901,452	K197R	probably benign	Het
Tgm2	C	A	2: 158,132,490	R207L	probably benign	Het
Trim29	G	T	9: 43,311,380	E169*	probably null	Het
Ttc24	T	C	3: 88,074,517	T81A	probably benign	Het
Ttll1	A	T	15: 83,492,577	I315N	probably damaging	Het
Ttll12	T	C	15: 83,577,013	N602D	probably damaging	Het
Vmn1r18	A	T	6: 57,390,116	V151E	probably benign	Het
Vmn2r100	T	A	17: 19,522,535	D390E	probably benign	Het
Zfp26	T	C	9: 20,436,716	T851A	probably benign	Het
Zfp58	T	G	13: 67,491,321	R350S	probably benign	Het

Other mutations in Aox3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Aox3	APN	1	58169794	missense	probably damaging	1.00
IGL01747:Aox3	APN	1	58159658	missense	probably damaging	0.97
IGL01883:Aox3	APN	1	58138283	missense	probably damaging	1.00
IGL01911:Aox3	APN	1	58152560	missense	probably benign	0.04
IGL02017:Aox3	APN	1	58120992	missense	probably damaging	1.00
IGL02120:Aox3	APN	1	58127650	missense	probably benign	0.00
IGL02466:Aox3	APN	1	58158272	missense	probably benign	0.28
IGL02545:Aox3	APN	1	58183486	missense	probably damaging	1.00
IGL02572:Aox3	APN	1	58158367	missense	probably damaging	1.00
IGL02746:Aox3	APN	1	58183542	missense	possibly damaging	0.83
IGL02808:Aox3	APN	1	58142700	missense	probably damaging	0.99
IGL02812:Aox3	APN	1	58165896	missense	probably benign	0.00
IGL02982:Aox3	APN	1	58127687	missense	probably benign	0.00
IGL03056:Aox3	APN	1	58159021	critical splice donor site	probably null
IGL03182:Aox3	APN	1	58165887	missense	probably benign	0.02
IGL03234:Aox3	APN	1	58152686	missense	probably benign
IGL03374:Aox3	APN	1	58171848	missense	probably damaging	1.00
amber	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0071:Aox3	UTSW	1	58171891	nonsense	probably null
R0135:Aox3	UTSW	1	58125088	splice site	probably benign
R0332:Aox3	UTSW	1	58142751	missense	probably benign	0.00
R0626:Aox3	UTSW	1	58172299	missense	possibly damaging	0.94
R1325:Aox3	UTSW	1	58176567	nonsense	probably null
R1435:Aox3	UTSW	1	58163446	critical splice donor site	probably null
R1438:Aox3	UTSW	1	58153178	missense	probably benign
R1567:Aox3	UTSW	1	58194693	missense	probably damaging	0.96
R1575:Aox3	UTSW	1	58152554	missense	probably benign	0.04
R1759:Aox3	UTSW	1	58170646	splice site	probably null
R1785:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1786:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R1921:Aox3	UTSW	1	58180651	missense	probably damaging	1.00
R1984:Aox3	UTSW	1	58153061	missense	possibly damaging	0.88
R2012:Aox3	UTSW	1	58138232	missense	probably benign	0.02
R2080:Aox3	UTSW	1	58186280	missense	probably benign	0.06
R2121:Aox3	UTSW	1	58152549	splice site	probably benign
R2126:Aox3	UTSW	1	58158216	missense	probably benign	0.25
R2130:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2131:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2132:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2133:Aox3	UTSW	1	58169843	missense	probably damaging	1.00
R2385:Aox3	UTSW	1	58138289	missense	probably damaging	1.00
R2495:Aox3	UTSW	1	58188408	missense	probably damaging	0.99
R4231:Aox3	UTSW	1	58114885	missense	probably benign	0.12
R4591:Aox3	UTSW	1	58152656	missense	probably damaging	0.99
R4627:Aox3	UTSW	1	58125035	missense	probably damaging	0.98
R4831:Aox3	UTSW	1	58152566	missense	probably damaging	0.97
R4864:Aox3	UTSW	1	58176487	missense	probably damaging	1.00
R4976:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5007:Aox3	UTSW	1	58163424	missense	probably benign
R5119:Aox3	UTSW	1	58188524	critical splice donor site	probably null
R5175:Aox3	UTSW	1	58172328	missense	probably benign	0.01
R5360:Aox3	UTSW	1	58146508	missense	probably damaging	1.00
R5784:Aox3	UTSW	1	58153499	missense	probably benign	0.00
R6050:Aox3	UTSW	1	58180655	missense	possibly damaging	0.93
R6056:Aox3	UTSW	1	58169859	missense	probably damaging	1.00
R6162:Aox3	UTSW	1	58159731	missense	possibly damaging	0.75
R6181:Aox3	UTSW	1	58158946	missense	probably benign	0.03
R6374:Aox3	UTSW	1	58172161	missense	probably benign	0.11
R6662:Aox3	UTSW	1	58118615	missense	probably damaging	1.00
R6809:Aox3	UTSW	1	58118681	missense	probably damaging	0.99
R6810:Aox3	UTSW	1	58141431	missense	probably benign	0.00
R6821:Aox3	UTSW	1	58150388	missense	probably benign	0.04
R7039:Aox3	UTSW	1	58176555	missense	probably damaging	1.00
R7116:Aox3	UTSW	1	58153530	missense	probably benign	0.01
R7146:Aox3	UTSW	1	58158529	intron	probably null
R7163:Aox3	UTSW	1	58119512	missense	probably damaging	0.99
R7243:Aox3	UTSW	1	58138307	missense	unknown
R7319:Aox3	UTSW	1	58152602	missense	probably benign	0.04
R7423:Aox3	UTSW	1	58121069	missense	possibly damaging	0.80
R7664:Aox3	UTSW	1	58119539	missense	probably damaging	1.00
R7709:Aox3	UTSW	1	58180651	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTTTCTGAAATCTACCCAGGGG -3'
(R):5'- CGTTTCTATGGAGCCTGACC -3'

Sequencing Primer
(F):5'- GTTCACATCTTCAGGTAGAACACAGG -3'
(R):5'- TGGAGCCTGACCATATATACTTACC -3'

Posted On

2015-06-10