Incidental Mutation 'R4200:Ifi203'
ID318707
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Nameinterferon activated gene 203
Synonyms
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173920407-173942672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 173924115 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 380 (I380S)
Ref Sequence ENSEMBL: ENSMUSP00000114221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
Predicted Effect probably damaging
Transcript: ENSMUST00000042228
AA Change: I380S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997
AA Change: I380S

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000081216
AA Change: I332S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997
AA Change: I332S

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123708
AA Change: I332S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997
AA Change: I332S

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128430
Predicted Effect possibly damaging
Transcript: ENSMUST00000129829
AA Change: I794S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: I794S

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135331
Predicted Effect probably damaging
Transcript: ENSMUST00000156895
AA Change: I380S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997
AA Change: I380S

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3415:Ifi203 UTSW 1 173928760 nonsense probably null
R3737:Ifi203 UTSW 1 173929474 intron probably benign
R3738:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4156:Ifi203 UTSW 1 173936540 missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6236:Ifi203 UTSW 1 173933913 missense probably benign 0.33
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R6929:Ifi203 UTSW 1 173928774 intron probably benign
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7631:Ifi203 UTSW 1 173927122 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R7994:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATACCTGCATGTAACTGTGCC -3'
(R):5'- TTTCTGTGAGGGTTGAGAAGAAAC -3'

Sequencing Primer
(F):5'- TGTGCCTTACAGACCTCAGGAG -3'
(R):5'- GAGTCCTGCTCATTGAACCTACTGAG -3'
Posted On2015-06-10