Incidental Mutation 'R4200:Mroh8'
ID318710
Institutional Source Beutler Lab
Gene Symbol Mroh8
Ensembl Gene ENSMUSG00000074627
Gene Namemaestro heat-like repeat family member 8
Synonyms4922505G16Rik
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157208550-157279549 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 157241810 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 381 (V381M)
Ref Sequence ENSEMBL: ENSMUSP00000124362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143663]
Predicted Effect probably benign
Transcript: ENSMUST00000143663
AA Change: V381M

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124362
Gene: ENSMUSG00000074627
AA Change: V381M

DomainStartEndE-ValueType
low complexity region 189 200 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
SCOP:d1qbkb_ 724 1024 8e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146848
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the maestro heat-like repeat family. The exact function of this gene is not known, however, in a genome-wide association study using hippocampal atrophy as a quantitative trait, this gene has been associated with Alzheimer's disease (PMID:19668339). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Mroh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mroh8 APN 2 157216914 missense probably damaging 1.00
IGL00691:Mroh8 APN 2 157238307 splice site probably benign
IGL00708:Mroh8 APN 2 157220170 missense probably damaging 1.00
IGL01526:Mroh8 APN 2 157238312 splice site probably benign
IGL01992:Mroh8 APN 2 157213696 missense probably damaging 1.00
IGL02076:Mroh8 APN 2 157271962 critical splice donor site probably null
IGL02308:Mroh8 APN 2 157254973 missense probably damaging 1.00
IGL02592:Mroh8 APN 2 157216969 missense probably damaging 0.96
PIT4378001:Mroh8 UTSW 2 157228700 missense possibly damaging 0.73
PIT4449001:Mroh8 UTSW 2 157225534 missense probably damaging 1.00
R0039:Mroh8 UTSW 2 157229929 missense possibly damaging 0.92
R0039:Mroh8 UTSW 2 157229929 missense possibly damaging 0.92
R0107:Mroh8 UTSW 2 157225468 missense probably benign 0.01
R0511:Mroh8 UTSW 2 157229918 missense probably damaging 1.00
R0523:Mroh8 UTSW 2 157224036 missense probably damaging 1.00
R0619:Mroh8 UTSW 2 157265081 missense possibly damaging 0.69
R1222:Mroh8 UTSW 2 157241854 splice site probably benign
R1418:Mroh8 UTSW 2 157241854 splice site probably benign
R1430:Mroh8 UTSW 2 157269525 missense possibly damaging 0.69
R1458:Mroh8 UTSW 2 157221304 missense probably damaging 1.00
R1509:Mroh8 UTSW 2 157233205 missense probably benign 0.14
R1528:Mroh8 UTSW 2 157230055 missense probably damaging 1.00
R1703:Mroh8 UTSW 2 157271976 missense probably benign 0.01
R1795:Mroh8 UTSW 2 157269551 missense probably benign 0.16
R1982:Mroh8 UTSW 2 157271975 missense possibly damaging 0.52
R3922:Mroh8 UTSW 2 157222811 missense probably benign 0.03
R4024:Mroh8 UTSW 2 157256352 missense probably benign 0.32
R4030:Mroh8 UTSW 2 157213720 missense probably damaging 1.00
R4492:Mroh8 UTSW 2 157258040 missense probably damaging 1.00
R4900:Mroh8 UTSW 2 157228727 missense probably benign 0.05
R5396:Mroh8 UTSW 2 157228656 missense possibly damaging 0.92
R5464:Mroh8 UTSW 2 157221230 missense probably damaging 1.00
R6008:Mroh8 UTSW 2 157253064 missense probably benign 0.40
R6220:Mroh8 UTSW 2 157233163 missense probably benign
R6661:Mroh8 UTSW 2 157225627 missense probably benign
R7000:Mroh8 UTSW 2 157216977 missense probably benign 0.03
R7024:Mroh8 UTSW 2 157221263 missense probably benign
R7221:Mroh8 UTSW 2 157229917 missense probably benign 0.06
R7549:Mroh8 UTSW 2 157269572 missense probably benign 0.01
R7593:Mroh8 UTSW 2 157229947 missense probably damaging 1.00
R7604:Mroh8 UTSW 2 157269564 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TACAAATGGCTAAAGAACAGGGTTC -3'
(R):5'- AATTTAGGTTGCCCTCTGTCAGG -3'

Sequencing Primer
(F):5'- GGTTCTGGACCTTGGGAAG -3'
(R):5'- TCTGTGAAACATTAGCCAGCC -3'
Posted On2015-06-10