Incidental Mutation 'R4200:Tgm2'
ID318711
Institutional Source Beutler Lab
Gene Symbol Tgm2
Ensembl Gene ENSMUSG00000037820
Gene Nametransglutaminase 2, C polypeptide
SynonymstTG, protein-glutamine gamma-glutamyltransferase, TGase2, TG2, TG C, G[a]h, tTGas, tissue transglutaminase
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158116402-158146436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 158132490 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 207 (R207L)
Ref Sequence ENSEMBL: ENSMUSP00000099411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103122] [ENSMUST00000152452] [ENSMUST00000174718]
Predicted Effect probably benign
Transcript: ENSMUST00000103122
AA Change: R207L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099411
Gene: ENSMUSG00000037820
AA Change: R207L

DomainStartEndE-ValueType
Pfam:Transglut_N 6 122 3.6e-34 PFAM
TGc 269 361 1.11e-38 SMART
Pfam:Transglut_C 473 572 5.7e-29 PFAM
Pfam:Transglut_C 586 685 2.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140923
Predicted Effect probably benign
Transcript: ENSMUST00000152452
SMART Domains Protein: ENSMUSP00000118434
Gene: ENSMUSG00000027651

DomainStartEndE-ValueType
RPR 8 130 1.71e-53 SMART
low complexity region 132 145 N/A INTRINSIC
PDB:4FLA|D 171 222 3e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152690
Predicted Effect probably benign
Transcript: ENSMUST00000174718
SMART Domains Protein: ENSMUSP00000133662
Gene: ENSMUSG00000037820

DomainStartEndE-ValueType
Pfam:Transglut_N 5 124 1.9e-37 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases are enzymes that catalyze the crosslinking of proteins by epsilon-gamma glutamyl lysine isopeptide bonds. While the primary structure of transglutaminases is not conserved, they all have the same amino acid sequence at their active sites and their activity is calcium-dependent. The protein encoded by this gene acts as a monomer, is induced by retinoic acid, and appears to be involved in apoptosis. Finally, the encoded protein is the autoantigen implicated in celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous null mutation causes alterations in glucose and aerobic energy metabolism, tumor growth, and response to myocardial infarction, liver injury, and LPS-induced sepsis. A second null mutation confers resistance to renal injury, while a third one alters cell adhesion and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Tgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01990:Tgm2 APN 2 158124131 missense probably benign
IGL03110:Tgm2 APN 2 158131490 nonsense probably null
IGL03397:Tgm2 APN 2 158120258 missense probably damaging 1.00
R0595:Tgm2 UTSW 2 158143042 missense probably damaging 1.00
R0786:Tgm2 UTSW 2 158124381 missense probably damaging 1.00
R1019:Tgm2 UTSW 2 158124154 nonsense probably null
R1395:Tgm2 UTSW 2 158124252 missense probably benign 0.01
R1732:Tgm2 UTSW 2 158134357 missense probably damaging 1.00
R1776:Tgm2 UTSW 2 158131459 missense probably benign 0.00
R1863:Tgm2 UTSW 2 158124219 missense probably damaging 1.00
R2863:Tgm2 UTSW 2 158143099 missense probably benign 0.01
R3036:Tgm2 UTSW 2 158124247 missense probably benign 0.00
R4370:Tgm2 UTSW 2 158124301 nonsense probably null
R4612:Tgm2 UTSW 2 158124204 missense probably benign 0.16
R5100:Tgm2 UTSW 2 158127164 missense probably benign 0.33
R5213:Tgm2 UTSW 2 158143060 missense possibly damaging 0.88
R5253:Tgm2 UTSW 2 158129438 missense probably damaging 1.00
R5585:Tgm2 UTSW 2 158131455 nonsense probably null
R5593:Tgm2 UTSW 2 158127342 missense probably damaging 1.00
R5616:Tgm2 UTSW 2 158128720 missense probably damaging 1.00
R5796:Tgm2 UTSW 2 158118904 missense probably benign 0.00
R5821:Tgm2 UTSW 2 158143054 missense possibly damaging 0.81
R5842:Tgm2 UTSW 2 158143081 missense probably damaging 1.00
R6317:Tgm2 UTSW 2 158124150 missense probably benign 0.18
R6610:Tgm2 UTSW 2 158143100 nonsense probably null
R7134:Tgm2 UTSW 2 158138892 missense probably benign
R7151:Tgm2 UTSW 2 158129395 missense possibly damaging 0.95
R7268:Tgm2 UTSW 2 158120268 nonsense probably null
R7719:Tgm2 UTSW 2 158143118 missense probably damaging 1.00
X0058:Tgm2 UTSW 2 158124147 missense probably benign 0.01
X0067:Tgm2 UTSW 2 158118845 critical splice donor site probably null
Z1177:Tgm2 UTSW 2 158117899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCTGAGAACCTCATTTG -3'
(R):5'- ATCCTAGGGGTGTCCAGAAC -3'

Sequencing Primer
(F):5'- CCCTGAGAACCTCATTTGTGTAGAG -3'
(R):5'- GAACCAGCTGGATTCCCACTTATTAG -3'
Posted On2015-06-10