Incidental Mutation 'R4200:Olfr573-ps1'
ID318721
Institutional Source Beutler Lab
Gene Symbol Olfr573-ps1
Ensembl Gene ENSMUSG00000052785
Gene Nameolfactory receptor 573, pseudogene 1
SynonymsMOR10-3P, MOR10-4, GA_x6K02T2PBJ9-5653743-5652872
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102941682-102942575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102941797 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 260 (F260S)
Ref Sequence ENSEMBL: ENSMUSP00000146786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064830] [ENSMUST00000210571]
Predicted Effect probably damaging
Transcript: ENSMUST00000064830
AA Change: F260S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065147
Gene: ENSMUSG00000052785
AA Change: F260S

DomainStartEndE-ValueType
Pfam:7tm_4 33 296 9.3e-109 PFAM
Pfam:7tm_1 43 288 4.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064830
AA Change: F260S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000210571
AA Change: F260S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Olfr573-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0472:Olfr573-ps1 UTSW 7 102942051 nonsense probably null
R1537:Olfr573-ps1 UTSW 7 102942340 missense probably damaging 1.00
R2168:Olfr573-ps1 UTSW 7 102942471 missense probably benign 0.00
R3781:Olfr573-ps1 UTSW 7 102942071 missense probably benign
R4198:Olfr573-ps1 UTSW 7 102941797 missense probably damaging 1.00
R4333:Olfr573-ps1 UTSW 7 102941969 missense possibly damaging 0.50
R4838:Olfr573-ps1 UTSW 7 102942246 missense probably damaging 1.00
R5041:Olfr573-ps1 UTSW 7 102942578 unclassified probably null
R5371:Olfr573-ps1 UTSW 7 102942512 missense probably benign
R5668:Olfr573-ps1 UTSW 7 102941921 missense probably benign 0.44
R7836:Olfr573-ps1 UTSW 7 102941918 missense possibly damaging 0.94
R7887:Olfr573-ps1 UTSW 7 102942151 missense possibly damaging 0.94
R7919:Olfr573-ps1 UTSW 7 102941918 missense possibly damaging 0.94
R7970:Olfr573-ps1 UTSW 7 102942151 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCGATTTCATTTGACTAGGCTC -3'
(R):5'- TCACCAAGATATGATGCGCC -3'

Sequencing Primer
(F):5'- GATTTCATTTGACTAGGCTCTGCTC -3'
(R):5'- CGTGTCAACAGCCTCTATGG -3'
Posted On2015-06-10