Incidental Mutation 'R4200:Olfr1357'
ID318729
Institutional Source Beutler Lab
Gene Symbol Olfr1357
Ensembl Gene ENSMUSG00000071185
Gene Nameolfactory receptor 1357
SynonymsMOR128-4, GA_x6K02T2QGN0-3196801-3197742, MOR128-3
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78611003-78618074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78612067 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 191 (D191E)
Ref Sequence ENSEMBL: ENSMUSP00000150167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095473] [ENSMUST00000203305] [ENSMUST00000205085] [ENSMUST00000213877]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095473
AA Change: D191E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093127
Gene: ENSMUSG00000071185
AA Change: D191E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203305
AA Change: D191E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145032
Gene: ENSMUSG00000071185
AA Change: D191E

DomainStartEndE-ValueType
Pfam:7tm_4 31 235 1.3e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 215 7.7e-11 PFAM
Pfam:7tm_1 41 234 3.4e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205085
AA Change: D191E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145185
Gene: ENSMUSG00000071185
AA Change: D191E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213877
AA Change: D191E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Olfr1357
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Olfr1357 APN 10 78612126 missense probably benign 0.02
IGL02201:Olfr1357 APN 10 78612270 missense probably damaging 0.96
IGL03029:Olfr1357 APN 10 78611958 missense probably benign 0.14
IGL03094:Olfr1357 APN 10 78612119 missense possibly damaging 0.80
R0207:Olfr1357 UTSW 10 78611871 missense probably benign
R0563:Olfr1357 UTSW 10 78612633 missense probably benign
R0745:Olfr1357 UTSW 10 78612122 missense probably benign 0.02
R1607:Olfr1357 UTSW 10 78612140 missense probably benign 0.08
R2419:Olfr1357 UTSW 10 78612387 missense probably benign 0.34
R4198:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4199:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4619:Olfr1357 UTSW 10 78612575 missense probably benign
R6152:Olfr1357 UTSW 10 78612575 missense probably benign
R6836:Olfr1357 UTSW 10 78612590 missense probably damaging 1.00
R6843:Olfr1357 UTSW 10 78612057 missense probably damaging 1.00
R7266:Olfr1357 UTSW 10 78612614 missense probably benign 0.07
R8104:Olfr1357 UTSW 10 78612408 missense probably benign 0.29
Z1176:Olfr1357 UTSW 10 78612056 missense probably damaging 1.00
Z1177:Olfr1357 UTSW 10 78612151 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GGGATGCTGGCAGTAAATATCCAG -3'
(R):5'- TCCGCTACTCAGTGCTCATG -3'

Sequencing Primer
(F):5'- TATCCAGTAAAGATGGTCCCGTAG -3'
(R):5'- ATGAGCCCACATGTCTGC -3'
Posted On2015-06-10