Incidental Mutation 'R4200:Foxg1'
ID318730
Institutional Source Beutler Lab
Gene Symbol Foxg1
Ensembl Gene ENSMUSG00000020950
Gene Nameforkhead box G1
SynonymsHfh9, BF-1, 2900064B05Rik, Hfhbf1, Bf1
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location49382660-49386861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49385299 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 272 (S272T)
Ref Sequence ENSEMBL: ENSMUSP00000136372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021333] [ENSMUST00000179669]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021333
AA Change: S272T

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021333
Gene: ENSMUSG00000020950
AA Change: S272T

DomainStartEndE-ValueType
low complexity region 32 91 N/A INTRINSIC
low complexity region 107 134 N/A INTRINSIC
FH 171 261 6.85e-63 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110746
AA Change: S42T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106374
Gene: ENSMUSG00000089922
AA Change: S42T

DomainStartEndE-ValueType
low complexity region 120 131 N/A INTRINSIC
low complexity region 169 198 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154930
Predicted Effect possibly damaging
Transcript: ENSMUST00000179669
AA Change: S272T

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136372
Gene: ENSMUSG00000020950
AA Change: S272T

DomainStartEndE-ValueType
low complexity region 32 91 N/A INTRINSIC
low complexity region 107 134 N/A INTRINSIC
FH 171 261 6.85e-63 SMART
low complexity region 367 378 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218927
Meta Mutation Damage Score 0.1912 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the forked-head transcription factor family. The encoded protein, which functions as a repressor, may play a role in brain development. Mutations at this locus have been associated with Rett syndrome. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutants exhibit dramatically reduced cerebral hemispheres, missing ventral telencephalic structures, impaired migration of efferent thalamocortical axons, and multiple eye defects. Mutants die at birth from respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Foxg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Foxg1 APN 12 49385620 missense possibly damaging 0.94
IGL02629:Foxg1 APN 12 49385548 missense probably benign 0.02
R0267:Foxg1 UTSW 12 49385582 missense probably damaging 1.00
R0486:Foxg1 UTSW 12 49384531 unclassified probably benign
R0646:Foxg1 UTSW 12 49384567 unclassified probably benign
R2110:Foxg1 UTSW 12 49384925 unclassified probably benign
R3784:Foxg1 UTSW 12 49385599 missense probably benign 0.04
R4198:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R4199:Foxg1 UTSW 12 49385299 missense possibly damaging 0.81
R4360:Foxg1 UTSW 12 49384692 small deletion probably benign
R5044:Foxg1 UTSW 12 49385186 missense probably damaging 1.00
R6053:Foxg1 UTSW 12 49385378 missense possibly damaging 0.62
R6277:Foxg1 UTSW 12 49385516 missense probably benign 0.06
R6485:Foxg1 UTSW 12 49385080 missense probably damaging 1.00
R6979:Foxg1 UTSW 12 49384784 unclassified probably benign
R7033:Foxg1 UTSW 12 49384720 unclassified probably benign
R8156:Foxg1 UTSW 12 49384646 missense unknown
R8193:Foxg1 UTSW 12 49385594 missense not run
Predicted Primers PCR Primer
(F):5'- TGAAGAACTTCCCCTACTACCG -3'
(R):5'- GAGTCAACACGGAGCTGTAG -3'

Sequencing Primer
(F):5'- TACTACCGCGAGAACAAGCAGG -3'
(R):5'- CACGGAGCTGTAGGGCATG -3'
Posted On2015-06-10