Incidental Mutation 'R4200:Zfp58'
ID318731
Institutional Source Beutler Lab
Gene Symbol Zfp58
Ensembl Gene ENSMUSG00000071291
Gene Namezinc finger protein 58
SynonymsZfp817, Mfg-1, A530094I17Rik, Mfg1
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67490167-67500555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 67491321 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 350 (R350S)
Ref Sequence ENSEMBL: ENSMUSP00000132285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076123] [ENSMUST00000091523] [ENSMUST00000163534] [ENSMUST00000167914] [ENSMUST00000171518]
Predicted Effect probably benign
Transcript: ENSMUST00000076123
AA Change: R350S

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075487
Gene: ENSMUSG00000071291
AA Change: R350S

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
ZnF_C2H2 162 184 5.67e-5 SMART
ZnF_C2H2 190 212 3.21e-4 SMART
ZnF_C2H2 218 240 2.57e-3 SMART
ZnF_C2H2 246 268 2.91e-2 SMART
ZnF_C2H2 274 296 9.73e-4 SMART
ZnF_C2H2 302 324 6.23e-2 SMART
ZnF_C2H2 330 352 1.03e-2 SMART
ZnF_C2H2 358 380 1.45e-2 SMART
ZnF_C2H2 386 408 2.99e-4 SMART
ZnF_C2H2 410 432 4.87e-4 SMART
ZnF_C2H2 438 460 2.75e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091523
SMART Domains Protein: ENSMUSP00000089108
Gene: ENSMUSG00000071291

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
ZnF_C2H2 162 184 5.67e-5 SMART
ZnF_C2H2 190 212 3.21e-4 SMART
ZnF_C2H2 218 240 2.57e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163534
SMART Domains Protein: ENSMUSP00000129177
Gene: ENSMUSG00000071291

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167914
SMART Domains Protein: ENSMUSP00000137830
Gene: ENSMUSG00000097565

DomainStartEndE-ValueType
KRAB 5 65 4.41e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171518
AA Change: R350S

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132285
Gene: ENSMUSG00000071291
AA Change: R350S

DomainStartEndE-ValueType
KRAB 2 62 2.19e-29 SMART
ZnF_C2H2 106 128 4.01e-5 SMART
ZnF_C2H2 134 156 9.73e-4 SMART
ZnF_C2H2 162 184 5.67e-5 SMART
ZnF_C2H2 190 212 3.21e-4 SMART
ZnF_C2H2 218 240 2.57e-3 SMART
ZnF_C2H2 246 268 2.91e-2 SMART
ZnF_C2H2 274 296 9.73e-4 SMART
ZnF_C2H2 302 324 6.23e-2 SMART
ZnF_C2H2 330 352 1.03e-2 SMART
ZnF_C2H2 358 380 1.45e-2 SMART
ZnF_C2H2 386 408 2.99e-4 SMART
ZnF_C2H2 410 432 4.87e-4 SMART
ZnF_C2H2 438 460 2.75e-3 SMART
ZnF_C2H2 466 488 1.58e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Other mutations in Zfp58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfp58 APN 13 67490995 missense probably benign 0.29
IGL02618:Zfp58 APN 13 67491356 missense possibly damaging 0.92
IGL03188:Zfp58 APN 13 67491409 missense probably benign 0.03
R0535:Zfp58 UTSW 13 67492082 nonsense probably null
R1470:Zfp58 UTSW 13 67492025 missense possibly damaging 0.71
R1470:Zfp58 UTSW 13 67492025 missense possibly damaging 0.71
R1750:Zfp58 UTSW 13 67491479 nonsense probably null
R1862:Zfp58 UTSW 13 67491188 missense probably damaging 1.00
R2697:Zfp58 UTSW 13 67491005 missense probably damaging 1.00
R3031:Zfp58 UTSW 13 67492112 missense probably benign 0.06
R3033:Zfp58 UTSW 13 67491622 missense probably damaging 1.00
R5827:Zfp58 UTSW 13 67491293 missense probably damaging 0.99
R6723:Zfp58 UTSW 13 67494073 missense probably damaging 1.00
R7230:Zfp58 UTSW 13 67491963 nonsense probably null
R7890:Zfp58 UTSW 13 67491995 missense possibly damaging 0.95
R7973:Zfp58 UTSW 13 67491995 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTTTTAAGGGATGAAGATCGGT -3'
(R):5'- TGTGCAGAATGTGGCAAAGC -3'

Sequencing Primer
(F):5'- GGGTTTCTCTCCAGTATGAACAAGC -3'
(R):5'- CCTTCATTGCTTAAGCGACATCAAAG -3'
Posted On2015-06-10