Incidental Mutation 'R4200:Nfatc4'
ID318732
Institutional Source Beutler Lab
Gene Symbol Nfatc4
Ensembl Gene ENSMUSG00000023411
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Synonyms3110041H08Rik
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55823144-55833943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55832032 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 672 (R672W)
Ref Sequence ENSEMBL: ENSMUSP00000132763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024179] [ENSMUST00000172271] [ENSMUST00000226357]
Predicted Effect probably damaging
Transcript: ENSMUST00000024179
AA Change: R672W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024179
Gene: ENSMUSG00000023411
AA Change: R672W

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD_DNA_bind 419 578 3.5e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172271
AA Change: R672W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132763
Gene: ENSMUSG00000023411
AA Change: R672W

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 82 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 151 190 N/A INTRINSIC
low complexity region 211 224 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 286 312 N/A INTRINSIC
Pfam:RHD 419 578 3.4e-23 PFAM
IPT 585 684 1.29e-21 SMART
low complexity region 700 711 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
low complexity region 803 825 N/A INTRINSIC
low complexity region 878 889 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226293
Predicted Effect probably damaging
Transcript: ENSMUST00000226357
AA Change: R602W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227746
Predicted Effect unknown
Transcript: ENSMUST00000228308
AA Change: R145W
Meta Mutation Damage Score 0.3134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear factor of activated T cells (NFAT) protein family. The encoded protein is part of a DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor stimulation and an inducible nuclear component. NFAT proteins are activated by the calmodulin-dependent phosphatase, calcineurin. The encoded protein plays a role in the inducible expression of cytokine genes in T cells, especially in the induction of interleukin-2 and interleukin-4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and exhibit normal embryonic heart morphology as well as normal pathophysiologic cardiac hypertrophy in response to angiotensin II infusion or aortic banding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Nfatc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Nfatc4 APN 14 55832562 missense probably damaging 1.00
IGL01295:Nfatc4 APN 14 55832505 missense probably benign 0.03
IGL01791:Nfatc4 APN 14 55832238 missense probably null 0.04
IGL02536:Nfatc4 APN 14 55829910 missense probably damaging 1.00
R0448:Nfatc4 UTSW 14 55831654 missense possibly damaging 0.90
R0571:Nfatc4 UTSW 14 55830028 missense probably damaging 0.96
R0743:Nfatc4 UTSW 14 55826644 missense probably damaging 1.00
R0884:Nfatc4 UTSW 14 55826644 missense probably damaging 1.00
R0965:Nfatc4 UTSW 14 55826586 missense probably damaging 1.00
R1141:Nfatc4 UTSW 14 55832631 missense probably damaging 1.00
R2309:Nfatc4 UTSW 14 55827004 missense probably damaging 1.00
R2680:Nfatc4 UTSW 14 55832834 unclassified probably benign
R4905:Nfatc4 UTSW 14 55830582 missense probably benign 0.16
R5067:Nfatc4 UTSW 14 55832418 missense probably damaging 0.98
R5202:Nfatc4 UTSW 14 55826659 missense probably damaging 1.00
R5415:Nfatc4 UTSW 14 55832634 missense probably benign
R5585:Nfatc4 UTSW 14 55826755 missense probably damaging 0.98
R5599:Nfatc4 UTSW 14 55832276 missense probably benign 0.02
R6030:Nfatc4 UTSW 14 55832440 nonsense probably null
R6030:Nfatc4 UTSW 14 55832440 nonsense probably null
R6172:Nfatc4 UTSW 14 55829533 missense possibly damaging 0.83
R7292:Nfatc4 UTSW 14 55825055 missense probably damaging 1.00
R7473:Nfatc4 UTSW 14 55831964 missense probably benign 0.19
R7738:Nfatc4 UTSW 14 55831957 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AACGGGCTTAACTCCTCAGC -3'
(R):5'- CCTCCTTGAAGACCACTAGGAAG -3'

Sequencing Primer
(F):5'- TAACTCCTCAGCCTTGGAACTAG -3'
(R):5'- TCCTTGAAGACCACTAGGAAGATGAG -3'
Posted On2015-06-10