Incidental Mutation 'R4200:Ttll1'
ID318734
Institutional Source Beutler Lab
Gene Symbol Ttll1
Ensembl Gene ENSMUSG00000022442
Gene Nametubulin tyrosine ligase-like 1
Synonyms
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83483769-83510893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83492577 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 315 (I315N)
Ref Sequence ENSEMBL: ENSMUSP00000105106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016897] [ENSMUST00000109479] [ENSMUST00000109480]
Predicted Effect probably damaging
Transcript: ENSMUST00000016897
AA Change: I315N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016897
Gene: ENSMUSG00000022442
AA Change: I315N

DomainStartEndE-ValueType
Pfam:TTL 50 364 5.3e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109479
SMART Domains Protein: ENSMUSP00000105105
Gene: ENSMUSG00000022442

DomainStartEndE-ValueType
Pfam:TTL 49 297 1.5e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109480
AA Change: I315N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105106
Gene: ENSMUSG00000022442
AA Change: I315N

DomainStartEndE-ValueType
Pfam:TTL 50 364 6.6e-116 PFAM
Meta Mutation Damage Score 0.9377 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit short sperm flagellum, abnormal tracheal cilia morphology and function, abnormal mucociliary clearance, and rhinosinitus with coughing or sneezing-like noises. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Ttll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Ttll1 APN 15 83484249 missense probably benign
IGL02744:Ttll1 APN 15 83489577 missense probably benign 0.00
R0639:Ttll1 UTSW 15 83502225 nonsense probably null
R1248:Ttll1 UTSW 15 83502125 missense probably benign 0.13
R1581:Ttll1 UTSW 15 83496277 missense probably damaging 0.99
R1599:Ttll1 UTSW 15 83497354 missense probably benign 0.36
R2264:Ttll1 UTSW 15 83496408 missense probably damaging 1.00
R2923:Ttll1 UTSW 15 83492559 missense probably damaging 0.97
R3786:Ttll1 UTSW 15 83484218 missense probably benign 0.00
R4364:Ttll1 UTSW 15 83499994 missense probably damaging 0.99
R4473:Ttll1 UTSW 15 83492609 missense probably damaging 0.99
R4590:Ttll1 UTSW 15 83497345 missense probably damaging 1.00
R4949:Ttll1 UTSW 15 83502173 missense probably null 1.00
R4970:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5112:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5231:Ttll1 UTSW 15 83489466 splice site probably null
R5911:Ttll1 UTSW 15 83502281 missense probably benign 0.07
R6368:Ttll1 UTSW 15 83489617 missense probably damaging 1.00
R6636:Ttll1 UTSW 15 83499946 missense probably damaging 1.00
R6959:Ttll1 UTSW 15 83502196 nonsense probably null
R7848:Ttll1 UTSW 15 83497372 missense probably damaging 0.97
R8207:Ttll1 UTSW 15 83500078 missense probably damaging 1.00
R8240:Ttll1 UTSW 15 83492582 missense probably damaging 1.00
R8717:Ttll1 UTSW 15 83489508 missense probably benign 0.01
Z1088:Ttll1 UTSW 15 83498189 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGCCCTGCTGTATGGTG -3'
(R):5'- GGTTTGAACCTGGTTGCACAG -3'

Sequencing Primer
(F):5'- AAAGCCCTGCTGTATGGTGTATATC -3'
(R):5'- TGTGCAAATGAGTGTATATGCACGC -3'
Posted On2015-06-10