Incidental Mutation 'R4200:Ttll12'
ID318735
Institutional Source Beutler Lab
Gene Symbol Ttll12
Ensembl Gene ENSMUSG00000016757
Gene Nametubulin tyrosine ligase-like family, member 12
Synonyms
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83575090-83595157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83577013 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 602 (N602D)
Ref Sequence ENSEMBL: ENSMUSP00000016901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016901] [ENSMUST00000047419] [ENSMUST00000136066] [ENSMUST00000208463]
Predicted Effect probably damaging
Transcript: ENSMUST00000016901
AA Change: N602D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000016901
Gene: ENSMUSG00000016757
AA Change: N602D

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
Pfam:TTL 341 637 7.4e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047419
SMART Domains Protein: ENSMUSP00000037039
Gene: ENSMUSG00000041736

DomainStartEndE-ValueType
Pfam:TspO_MBR 9 157 1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134334
Predicted Effect probably benign
Transcript: ENSMUST00000136066
SMART Domains Protein: ENSMUSP00000117161
Gene: ENSMUSG00000016757

DomainStartEndE-ValueType
low complexity region 46 60 N/A INTRINSIC
low complexity region 66 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208463
Meta Mutation Damage Score 0.9210 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Ttll12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ttll12 APN 15 83578656 missense probably benign 0.15
IGL00942:Ttll12 APN 15 83582448 missense possibly damaging 0.65
IGL01746:Ttll12 APN 15 83578676 missense probably damaging 1.00
IGL02102:Ttll12 APN 15 83582063 missense probably damaging 1.00
IGL02475:Ttll12 APN 15 83587101 missense probably damaging 1.00
IGL02484:Ttll12 APN 15 83581696 missense possibly damaging 0.94
R0403:Ttll12 UTSW 15 83580658 splice site probably benign
R1477:Ttll12 UTSW 15 83580102 missense probably damaging 1.00
R1530:Ttll12 UTSW 15 83588655 missense probably damaging 1.00
R1925:Ttll12 UTSW 15 83581775 missense probably benign 0.06
R3508:Ttll12 UTSW 15 83580630 missense probably damaging 0.98
R3972:Ttll12 UTSW 15 83582096 missense probably damaging 1.00
R4198:Ttll12 UTSW 15 83577013 missense probably damaging 1.00
R4357:Ttll12 UTSW 15 83581757 missense probably damaging 1.00
R4740:Ttll12 UTSW 15 83580120 missense probably damaging 1.00
R5024:Ttll12 UTSW 15 83587113 missense probably damaging 1.00
R5870:Ttll12 UTSW 15 83577036 missense probably damaging 0.97
R6824:Ttll12 UTSW 15 83591377 critical splice donor site probably null
R7034:Ttll12 UTSW 15 83586885 missense probably benign
R7036:Ttll12 UTSW 15 83586885 missense probably benign
R7447:Ttll12 UTSW 15 83586975 missense probably damaging 1.00
Z1088:Ttll12 UTSW 15 83582078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGGCAGTTCTGTGAGCAG -3'
(R):5'- AGGGGTAGCTTCAGCCTTTC -3'

Sequencing Primer
(F):5'- AGAGGCTGGACCGGCTG -3'
(R):5'- GGTCTCAAGCTAGGGAATGTACATTC -3'
Posted On2015-06-10