Incidental Mutation 'R4200:Slc1a1'
ID318740
Institutional Source Beutler Lab
Gene Symbol Slc1a1
Ensembl Gene ENSMUSG00000024935
Gene Namesolute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1
SynonymsD130048G10Rik, MEAAC1, EAAC1, EAAT3
MMRRC Submission 041030-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4200 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location28835049-28913960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28901452 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 197 (K197R)
Ref Sequence ENSEMBL: ENSMUSP00000025875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025875] [ENSMUST00000175647] [ENSMUST00000179171]
Predicted Effect probably benign
Transcript: ENSMUST00000025875
AA Change: K197R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025875
Gene: ENSMUSG00000024935
AA Change: K197R

DomainStartEndE-ValueType
Pfam:SDF 20 464 2.3e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162189
Predicted Effect probably benign
Transcript: ENSMUST00000175647
SMART Domains Protein: ENSMUSP00000135813
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
Pfam:SPATA6 6 78 4.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179171
SMART Domains Protein: ENSMUSP00000137486
Gene: ENSMUSG00000064202

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the high-affinity glutamate transporters that play an essential role in transporting glutamate across plasma membranes. In brain, these transporters are crucial in terminating the postsynaptic action of the neurotransmitter glutamate, and in maintaining extracellular glutamate concentrations below neurotoxic levels. This transporter also transports aspartate, and mutations in this gene are thought to cause dicarboxylicamino aciduria, also known as glutamate-aspartate transport defect. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced locomotor activity and excessive excretion of glutamate and aspartate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T A 3: 60,039,534 Y218N probably damaging Het
Aox3 A G 1: 58,188,378 E1214G probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Asxl1 C A 2: 153,400,106 L859I possibly damaging Het
C7 A G 15: 4,990,309 probably null Het
Col6a3 C A 1: 90,801,383 V1279L probably benign Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Etl4 C A 2: 20,781,883 H481Q probably damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Gm3336 A T 8: 70,720,612 D91V probably benign Het
Hnf4g T G 3: 3,651,284 V256G possibly damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Ifi203 A C 1: 173,924,115 I380S probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Mboat7 C A 7: 3,685,753 A259S possibly damaging Het
Mroh8 C T 2: 157,241,810 V381M probably benign Het
Muc5b T A 7: 141,858,925 C1869* probably null Het
Nfatc4 C T 14: 55,832,032 R672W probably damaging Het
Nup210l T C 3: 90,119,911 I200T probably damaging Het
Olfr1357 A T 10: 78,612,067 D191E possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olr1 A G 6: 129,502,105 V50A probably damaging Het
Pcdhgb5 A G 18: 37,731,982 I277V possibly damaging Het
Pknox1 C A 17: 31,599,610 N272K probably benign Het
Psg23 T C 7: 18,612,065 D235G probably damaging Het
Tgm2 C A 2: 158,132,490 R207L probably benign Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttc24 T C 3: 88,074,517 T81A probably benign Het
Ttll1 A T 15: 83,492,577 I315N probably damaging Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Vmn1r18 A T 6: 57,390,116 V151E probably benign Het
Vmn2r100 T A 17: 19,522,535 D390E probably benign Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp58 T G 13: 67,491,321 R350S probably benign Het
Other mutations in Slc1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Slc1a1 APN 19 28902753 missense possibly damaging 0.66
IGL02726:Slc1a1 APN 19 28911769 missense probably benign 0.04
IGL02865:Slc1a1 APN 19 28905338 missense probably damaging 1.00
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R0008:Slc1a1 UTSW 19 28901484 missense probably benign 0.01
R0490:Slc1a1 UTSW 19 28897531 missense probably benign
R1219:Slc1a1 UTSW 19 28904746 splice site probably benign
R1333:Slc1a1 UTSW 19 28835211 start gained probably benign
R1623:Slc1a1 UTSW 19 28904722 missense probably benign 0.09
R1669:Slc1a1 UTSW 19 28911794 missense probably benign 0.04
R1746:Slc1a1 UTSW 19 28894469 missense probably benign 0.31
R2516:Slc1a1 UTSW 19 28892912 missense probably benign 0.31
R4198:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4199:Slc1a1 UTSW 19 28901452 missense probably benign 0.00
R4432:Slc1a1 UTSW 19 28902709 missense probably benign 0.21
R4744:Slc1a1 UTSW 19 28894525 missense probably benign
R5110:Slc1a1 UTSW 19 28911808 missense probably benign 0.14
R5341:Slc1a1 UTSW 19 28897568 missense probably benign
R6136:Slc1a1 UTSW 19 28905410 missense probably damaging 1.00
R6153:Slc1a1 UTSW 19 28909535 missense probably damaging 0.98
R6640:Slc1a1 UTSW 19 28894570 critical splice donor site probably null
R8182:Slc1a1 UTSW 19 28901448 missense not run
RF020:Slc1a1 UTSW 19 28879155 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACATGTTCATGGAGGAGCTTG -3'
(R):5'- ATAAGCCTCCTCTTCCCAGG -3'

Sequencing Primer
(F):5'- GCTTGTTAAGGAGACAAAGCCCC -3'
(R):5'- TCCCAGGTCTGAGAAGGCATTATC -3'
Posted On2015-06-10