Incidental Mutation 'R4201:Camk1d'
ID318744
Institutional Source Beutler Lab
Gene Symbol Camk1d
Ensembl Gene ENSMUSG00000039145
Gene Namecalcium/calmodulin-dependent protein kinase ID
SynonymsE030025C11Rik, CaMKIdelta, CKLiK, A630059D12Rik
MMRRC Submission 041031-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4201 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location5293457-5714515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5354776 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 145 (Y145C)
Ref Sequence ENSEMBL: ENSMUSP00000110638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044009] [ENSMUST00000114987]
Predicted Effect probably benign
Transcript: ENSMUST00000044009
AA Change: Y153C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000037028
Gene: ENSMUSG00000039145
AA Change: Y153C

DomainStartEndE-ValueType
S_TKc 23 279 5.87e-112 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 358 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114987
AA Change: Y145C

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110638
Gene: ENSMUSG00000039145
AA Change: Y145C

DomainStartEndE-ValueType
S_TKc 23 271 1.35e-102 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 350 360 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the calcium/calmodulin-dependent protein kinase 1 family, a subfamily of the serine/threonine kinases. The encoded protein is a component of the calcium-regulated calmodulin-dependent protein kinase cascade. It has been associated with multiple processes including regulation of granulocyte function, activation of CREB-dependent gene transcription, aldosterone synthesis, differentiation and activation of neutrophil cells, and apoptosis of erythroleukemia cells. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,623,952 probably null Het
Als2 A T 1: 59,180,154 D1212E possibly damaging Het
Arfgef3 A G 10: 18,619,782 S1167P probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp1b2 A G 11: 69,603,469 V66A possibly damaging Het
Bag3 C A 7: 128,546,157 L499I probably damaging Het
Boc T C 16: 44,490,618 D751G probably damaging Het
Ccdc172 G A 19: 58,536,585 R158H probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cd9 T C 6: 125,462,394 D125G possibly damaging Het
Cep295 T C 9: 15,332,538 I1493V probably benign Het
Chrna5 A G 9: 54,998,075 D57G probably benign Het
Cul7 C T 17: 46,661,312 R1201W probably damaging Het
Dnah1 A G 14: 31,262,270 V3976A probably benign Het
Dnah11 T C 12: 117,966,659 D3317G possibly damaging Het
Dnmt3b G T 2: 153,670,417 E353* probably null Het
Gch1 T C 14: 47,155,803 S241G probably benign Het
Gpr22 A T 12: 31,708,913 Y366* probably null Het
Gse1 A T 8: 120,567,764 M277L probably benign Het
Kcnt2 G A 1: 140,425,332 V260I probably damaging Het
Nbas G T 12: 13,374,826 C1022F probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr807 A T 10: 129,754,628 L274H probably damaging Het
Parp4 C A 14: 56,592,391 T274K possibly damaging Het
Pgs1 A G 11: 118,002,536 S230G probably damaging Het
Plin4 T G 17: 56,104,338 T898P probably damaging Het
Ptprj A C 2: 90,463,095 V548G probably damaging Het
Sec23a T C 12: 59,002,005 I139M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Syne1 A T 10: 5,347,870 D1142E probably benign Het
Tbccd1 A G 16: 22,825,948 V226A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmed7 A G 18: 46,593,247 probably null Het
Tnfrsf23 A T 7: 143,670,054 C137S probably damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Other mutations in Camk1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Camk1d APN 2 5311073 splice site probably benign
IGL02138:Camk1d APN 2 5445084 nonsense probably null
IGL02826:Camk1d APN 2 5565760 missense possibly damaging 0.56
IGL02999:Camk1d APN 2 5354705 missense probably benign 0.44
R0432:Camk1d UTSW 2 5445135 missense probably damaging 1.00
R1180:Camk1d UTSW 2 5362025 nonsense probably null
R1448:Camk1d UTSW 2 5362025 nonsense probably null
R1628:Camk1d UTSW 2 5311037 missense probably damaging 0.99
R1850:Camk1d UTSW 2 5362015 missense probably benign 0.08
R1998:Camk1d UTSW 2 5362025 nonsense probably null
R2000:Camk1d UTSW 2 5362025 nonsense probably null
R2513:Camk1d UTSW 2 5714236 start codon destroyed probably null 0.15
R4065:Camk1d UTSW 2 5565773 missense probably damaging 1.00
R4581:Camk1d UTSW 2 5354704 missense probably benign 0.21
R4760:Camk1d UTSW 2 5362056 missense probably damaging 1.00
R4894:Camk1d UTSW 2 5354728 missense probably damaging 1.00
R5001:Camk1d UTSW 2 5313101 missense possibly damaging 0.50
R5394:Camk1d UTSW 2 5303366 missense probably benign 0.10
R5754:Camk1d UTSW 2 5445097 missense probably benign 0.10
R5754:Camk1d UTSW 2 5445099 missense probably damaging 1.00
R5877:Camk1d UTSW 2 5565665 missense probably benign 0.00
R6444:Camk1d UTSW 2 5313145 missense probably damaging 1.00
R7315:Camk1d UTSW 2 5339230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCAATGCTTCAGAAGG -3'
(R):5'- TGAAACTCCCATTAGTAAGACAGC -3'

Sequencing Primer
(F):5'- TTCAGAAGGAAGATGAAGTTGACATG -3'
(R):5'- GGCATCAAGTCCAAGGCTTCTTG -3'
Posted On2015-06-10