Incidental Mutation 'R4201:Stx17'
ID318748
Institutional Source Beutler Lab
Gene Symbol Stx17
Ensembl Gene ENSMUSG00000061455
Gene Namesyntaxin 17
Synonyms9030425C21Rik, 6330411F21Rik, 4833418L03Rik
MMRRC Submission 041031-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4201 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location48124915-48186507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48158870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 83 (D83E)
Ref Sequence ENSEMBL: ENSMUSP00000117512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064765] [ENSMUST00000107720] [ENSMUST00000107721] [ENSMUST00000153502]
Predicted Effect probably damaging
Transcript: ENSMUST00000064765
AA Change: D83E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068087
Gene: ENSMUSG00000061455
AA Change: D83E

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107720
AA Change: D83E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103348
Gene: ENSMUSG00000061455
AA Change: D83E

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107721
AA Change: D61E

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103349
Gene: ENSMUSG00000061455
AA Change: D61E

DomainStartEndE-ValueType
low complexity region 52 66 N/A INTRINSIC
t_SNARE 134 201 9.65e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153502
AA Change: D83E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117512
Gene: ENSMUSG00000061455
AA Change: D83E

DomainStartEndE-ValueType
coiled coil region 51 74 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,623,952 probably null Het
Als2 A T 1: 59,180,154 D1212E possibly damaging Het
Arfgef3 A G 10: 18,619,782 S1167P probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp1b2 A G 11: 69,603,469 V66A possibly damaging Het
Bag3 C A 7: 128,546,157 L499I probably damaging Het
Boc T C 16: 44,490,618 D751G probably damaging Het
Camk1d T C 2: 5,354,776 Y145C probably benign Het
Ccdc172 G A 19: 58,536,585 R158H probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cd9 T C 6: 125,462,394 D125G possibly damaging Het
Cep295 T C 9: 15,332,538 I1493V probably benign Het
Chrna5 A G 9: 54,998,075 D57G probably benign Het
Cul7 C T 17: 46,661,312 R1201W probably damaging Het
Dnah1 A G 14: 31,262,270 V3976A probably benign Het
Dnah11 T C 12: 117,966,659 D3317G possibly damaging Het
Dnmt3b G T 2: 153,670,417 E353* probably null Het
Gch1 T C 14: 47,155,803 S241G probably benign Het
Gpr22 A T 12: 31,708,913 Y366* probably null Het
Gse1 A T 8: 120,567,764 M277L probably benign Het
Kcnt2 G A 1: 140,425,332 V260I probably damaging Het
Nbas G T 12: 13,374,826 C1022F probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr807 A T 10: 129,754,628 L274H probably damaging Het
Parp4 C A 14: 56,592,391 T274K possibly damaging Het
Pgs1 A G 11: 118,002,536 S230G probably damaging Het
Plin4 T G 17: 56,104,338 T898P probably damaging Het
Ptprj A C 2: 90,463,095 V548G probably damaging Het
Sec23a T C 12: 59,002,005 I139M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Syne1 A T 10: 5,347,870 D1142E probably benign Het
Tbccd1 A G 16: 22,825,948 V226A probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmed7 A G 18: 46,593,247 probably null Het
Tnfrsf23 A T 7: 143,670,054 C137S probably damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Other mutations in Stx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stx17 APN 4 48158955 missense possibly damaging 0.72
IGL01625:Stx17 APN 4 48181526 missense probably damaging 1.00
IGL01975:Stx17 APN 4 48180670 missense probably damaging 1.00
R1977:Stx17 UTSW 4 48181553 missense probably benign 0.00
R2069:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R4117:Stx17 UTSW 4 48180689 missense probably damaging 1.00
R4202:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R5265:Stx17 UTSW 4 48183470 utr 3 prime probably benign
R5308:Stx17 UTSW 4 48182851 utr 3 prime probably benign
R6414:Stx17 UTSW 4 48158809 critical splice acceptor site probably null
R6499:Stx17 UTSW 4 48183478 critical splice donor site probably null
R6969:Stx17 UTSW 4 48140462 missense probably damaging 1.00
R7062:Stx17 UTSW 4 48140442 missense probably benign 0.07
R7482:Stx17 UTSW 4 48181722 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGGCATGGATTCTAGTCTAGCC -3'
(R):5'- CATATGTTACCATCAACAGTTGTGG -3'

Sequencing Primer
(F):5'- TGTCCCTGTAGAAGACAATTGG -3'
(R):5'- ACCATCAACAGTTGTGGATCTGG -3'
Posted On2015-06-10